ID: 948496409

View in Genome Browser
Species Human (GRCh38)
Location 2:238352553-238352575
Sequence CAGGCCTCCTGGTCCACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 331}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948496409_948496417 -4 Left 948496409 2:238352553-238352575 CCAGGTGTGGACCAGGAGGCCTG 0: 1
1: 1
2: 0
3: 25
4: 331
Right 948496417 2:238352572-238352594 CCTGGGCAGCACAGGGACGTGGG 0: 1
1: 0
2: 2
3: 24
4: 298
948496409_948496427 18 Left 948496409 2:238352553-238352575 CCAGGTGTGGACCAGGAGGCCTG 0: 1
1: 1
2: 0
3: 25
4: 331
Right 948496427 2:238352594-238352616 GGAAGCTGGGTGGGGGTGGAGGG 0: 1
1: 3
2: 20
3: 165
4: 1380
948496409_948496415 -5 Left 948496409 2:238352553-238352575 CCAGGTGTGGACCAGGAGGCCTG 0: 1
1: 1
2: 0
3: 25
4: 331
Right 948496415 2:238352571-238352593 GCCTGGGCAGCACAGGGACGTGG 0: 1
1: 0
2: 4
3: 59
4: 389
948496409_948496426 17 Left 948496409 2:238352553-238352575 CCAGGTGTGGACCAGGAGGCCTG 0: 1
1: 1
2: 0
3: 25
4: 331
Right 948496426 2:238352593-238352615 GGGAAGCTGGGTGGGGGTGGAGG 0: 4
1: 2
2: 39
3: 362
4: 2472
948496409_948496428 23 Left 948496409 2:238352553-238352575 CCAGGTGTGGACCAGGAGGCCTG 0: 1
1: 1
2: 0
3: 25
4: 331
Right 948496428 2:238352599-238352621 CTGGGTGGGGGTGGAGGGCGAGG 0: 1
1: 4
2: 30
3: 291
4: 2314
948496409_948496424 11 Left 948496409 2:238352553-238352575 CCAGGTGTGGACCAGGAGGCCTG 0: 1
1: 1
2: 0
3: 25
4: 331
Right 948496424 2:238352587-238352609 GACGTGGGGAAGCTGGGTGGGGG 0: 1
1: 1
2: 3
3: 44
4: 471
948496409_948496419 4 Left 948496409 2:238352553-238352575 CCAGGTGTGGACCAGGAGGCCTG 0: 1
1: 1
2: 0
3: 25
4: 331
Right 948496419 2:238352580-238352602 GCACAGGGACGTGGGGAAGCTGG 0: 1
1: 0
2: 1
3: 33
4: 371
948496409_948496420 5 Left 948496409 2:238352553-238352575 CCAGGTGTGGACCAGGAGGCCTG 0: 1
1: 1
2: 0
3: 25
4: 331
Right 948496420 2:238352581-238352603 CACAGGGACGTGGGGAAGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 251
948496409_948496423 10 Left 948496409 2:238352553-238352575 CCAGGTGTGGACCAGGAGGCCTG 0: 1
1: 1
2: 0
3: 25
4: 331
Right 948496423 2:238352586-238352608 GGACGTGGGGAAGCTGGGTGGGG 0: 1
1: 0
2: 0
3: 55
4: 708
948496409_948496422 9 Left 948496409 2:238352553-238352575 CCAGGTGTGGACCAGGAGGCCTG 0: 1
1: 1
2: 0
3: 25
4: 331
Right 948496422 2:238352585-238352607 GGGACGTGGGGAAGCTGGGTGGG 0: 1
1: 0
2: 7
3: 54
4: 480
948496409_948496418 -3 Left 948496409 2:238352553-238352575 CCAGGTGTGGACCAGGAGGCCTG 0: 1
1: 1
2: 0
3: 25
4: 331
Right 948496418 2:238352573-238352595 CTGGGCAGCACAGGGACGTGGGG 0: 1
1: 0
2: 1
3: 26
4: 300
948496409_948496425 14 Left 948496409 2:238352553-238352575 CCAGGTGTGGACCAGGAGGCCTG 0: 1
1: 1
2: 0
3: 25
4: 331
Right 948496425 2:238352590-238352612 GTGGGGAAGCTGGGTGGGGGTGG 0: 1
1: 4
2: 14
3: 197
4: 1525
948496409_948496421 8 Left 948496409 2:238352553-238352575 CCAGGTGTGGACCAGGAGGCCTG 0: 1
1: 1
2: 0
3: 25
4: 331
Right 948496421 2:238352584-238352606 AGGGACGTGGGGAAGCTGGGTGG 0: 1
1: 1
2: 6
3: 67
4: 587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948496409 Original CRISPR CAGGCCTCCTGGTCCACACC TGG (reversed) Intronic
900424680 1:2570890-2570912 CAGGCCTGGTGGCGCACACCTGG + Intergenic
900437235 1:2636829-2636851 CAGCCTGCCTGGGCCACACCTGG + Intronic
900966034 1:5959276-5959298 CGGGCCGGCTGCTCCACACCTGG + Intronic
900988549 1:6087054-6087076 CCTGCCCCCTGGCCCACACCCGG + Intronic
902623108 1:17661796-17661818 CAGGGATGCTGGTCCACAGCAGG - Intronic
902717542 1:18282989-18283011 CAGGCTTCCTTGTTCACAGCAGG + Intronic
903375271 1:22861901-22861923 CAGGCCCCCAGGCCCTCACCGGG - Intronic
903777329 1:25800979-25801001 CTGGTCTCCTGGTCCCCAACAGG - Intronic
905144460 1:35876928-35876950 CAGGCATGCTCCTCCACACCTGG + Intronic
905414695 1:37795734-37795756 CAGGCGTCCTGGTCCTGTCCTGG + Exonic
905809897 1:40904539-40904561 CAGGCATGGTGGTGCACACCTGG + Intergenic
906259776 1:44378148-44378170 CAGGCCTCCTAGTTCCCTCCAGG + Intergenic
906524039 1:46484155-46484177 CAGGCCTCCTTGTACACACAAGG + Intergenic
907899315 1:58722845-58722867 CTGGCCTCTTCCTCCACACCAGG - Intergenic
910575139 1:88753805-88753827 CAGGCCTCATGTTCAACACTGGG + Intronic
912466240 1:109876959-109876981 CAGGCAGCCTGGTCCATACCTGG - Intergenic
913319378 1:117577683-117577705 CAGCCCTCCTGGTCCTGGCCTGG - Intergenic
914851312 1:151316327-151316349 CAGGCCTTCTGGGCCACCTCAGG + Exonic
915267048 1:154726436-154726458 CAGGCCTGCTGGTCTAGAGCTGG - Intronic
915669093 1:157472449-157472471 CAGGCTTCCTGATGCAAACCAGG - Intergenic
916344913 1:163776894-163776916 CAGGCCCCATGCTCCACACAAGG + Intergenic
916529987 1:165647866-165647888 CAGGCAGCCTGGGCCACACAGGG - Intronic
920256687 1:204660166-204660188 CAGGACTCCTGCTCCTCTCCAGG + Intronic
921046470 1:211481352-211481374 CAGGGCTCCTGGTGGACAGCCGG + Exonic
922242527 1:223765287-223765309 CAGCCCTCTTGGTTCACACTGGG - Intronic
923104009 1:230840490-230840512 CAGGCCTTGTGGTGCACGCCTGG - Intronic
923169515 1:231400906-231400928 CAGGCATGCTGGTGCACATCTGG + Intronic
923409156 1:233690375-233690397 CAGCCCTCCTGTTCCATTCCAGG + Intergenic
1063605133 10:7516709-7516731 CAGGCGTCCTCCACCACACCCGG + Intergenic
1067012199 10:42724759-42724781 CTGGCCTCCTGGGGCACCCCTGG + Intergenic
1067142613 10:43669444-43669466 CAGGCCTCCTGGGCCAGGCAGGG + Intergenic
1067182516 10:43999682-43999704 CAGGCTTTCTGGTTGACACCTGG - Intergenic
1067311396 10:45117134-45117156 CTGGCCTCCTGGGGCACCCCTGG - Intergenic
1067777159 10:49171965-49171987 CACGCCTACTGGCCCACAACTGG - Intronic
1068065156 10:52121105-52121127 CAGCACTCCTGGGCCACCCCAGG - Intronic
1069395320 10:67981678-67981700 CAGGCATGGTGGTTCACACCGGG + Intronic
1070109080 10:73464787-73464809 CAGGCATGCTGTACCACACCTGG - Intronic
1070311243 10:75275653-75275675 CAGGCAGCCTGGGCCTCACCTGG + Intergenic
1070727896 10:78804515-78804537 CACGTCTCCTGGTCCTCCCCAGG + Intergenic
1072187964 10:93060451-93060473 CAGTGCTCCTGGCCCACCCCCGG - Intergenic
1072487808 10:95873264-95873286 CAGGCATTCTGTTCCACAGCAGG + Exonic
1073477911 10:103766372-103766394 CGGGCCTCCTGGTCCATGTCTGG - Intronic
1076369167 10:129940759-129940781 CTGGCATCCTGGGCCACCCCTGG - Intronic
1076374346 10:129973198-129973220 GAGGCCTCCTGGGCCACGCGCGG + Intergenic
1076852883 10:133101695-133101717 CAGGCCTCCCTGTCTCCACCAGG + Intronic
1076919658 10:133445057-133445079 CTGGTGTCCTGGTCCACACGGGG + Intergenic
1077222643 11:1424382-1424404 CAGGACACCTTGTCCCCACCTGG - Intronic
1077303043 11:1855909-1855931 GGGGCGTCCTGGTCCACAGCTGG + Intronic
1077348480 11:2076423-2076445 CAGGCATGGTGGTGCACACCTGG - Intergenic
1077434901 11:2534261-2534283 CAGGCCCGCAGGTCCTCACCTGG + Intronic
1077538846 11:3137153-3137175 CAGGCCTCCTGAGTCACCCCAGG + Intronic
1080017457 11:27522393-27522415 CAGCCCTCCTGTTCTACACTAGG + Intergenic
1080772438 11:35354316-35354338 CAGGCATGATGGTGCACACCTGG + Intronic
1083030496 11:59587357-59587379 CAGGCCCCCTGCAACACACCCGG - Intronic
1083176003 11:60950975-60950997 CAGGCCTCCTGCCACTCACCTGG + Exonic
1084910154 11:72381694-72381716 CCAGCCTCCAGGTCCACCCCAGG + Intronic
1085407362 11:76271222-76271244 CAGGCCTTCTGCTTCACTCCAGG + Intergenic
1088468263 11:110165182-110165204 CAAGCCTCCTCTTCCGCACCTGG + Exonic
1089846751 11:121464759-121464781 CAGGCCTCCCTGTCCCCAGCTGG - Intronic
1090226425 11:125074725-125074747 CTGGCTTCCTAGTCAACACCAGG + Intronic
1091076449 11:132622556-132622578 GAGGCCTCCTGACCCACATCAGG - Intronic
1091480190 12:820614-820636 CAGGCATGGTGGTACACACCTGG - Intronic
1097358185 12:58626081-58626103 CTGGCCTCATGGTCCACTCAGGG + Intronic
1097679652 12:62636856-62636878 CAGGACTACAGGTGCACACCCGG + Intergenic
1101593135 12:106139938-106139960 CCGGGGTCCTGGTCCACCCCAGG - Exonic
1101594422 12:106151305-106151327 CAGCCCACTCGGTCCACACCTGG + Intergenic
1102119426 12:110429185-110429207 CAGGGCTCGTGGGCCTCACCTGG + Intergenic
1102208555 12:111107295-111107317 AAGGACTCCAGGTGCACACCAGG - Intronic
1102513881 12:113433980-113434002 GAGGCCTCTGGGCCCACACCAGG + Intronic
1102587324 12:113932535-113932557 CAGGCGTCCGAGTCCACAGCTGG + Intronic
1102687031 12:114732709-114732731 CAGGTCTCCTGGTCCAGTCCCGG - Intergenic
1103593249 12:122007172-122007194 CAGGCCTGCGGCACCACACCTGG + Intergenic
1103620420 12:122183786-122183808 AAGCCTTCCTGGGCCACACCTGG - Intronic
1103937064 12:124482441-124482463 CAGGCCACCTGGGCCAGACTCGG - Intronic
1104748516 12:131224311-131224333 CATGCCTCCTGTTTCACACCTGG - Intergenic
1104889250 12:132132494-132132516 CAGCTCCCCTGGACCACACCTGG - Intergenic
1104912312 12:132245163-132245185 CAGGCGTGGTGGTTCACACCTGG + Intronic
1105716101 13:23066417-23066439 CAGGCATCATGTTACACACCAGG + Intergenic
1105723069 13:23135289-23135311 CAGGGCTCATGGGCCTCACCTGG - Intergenic
1106394761 13:29368932-29368954 CAGGCCTACTGCTCCTTACCTGG - Intronic
1108727863 13:53201427-53201449 AGGGCCTCCTGGTGCACAGCGGG - Intergenic
1112271409 13:97973790-97973812 CAGGCCTCCGCCACCACACCCGG - Intronic
1113907894 13:113828824-113828846 GAGGCCACCTGATCCTCACCTGG + Intronic
1113907971 13:113829100-113829122 GAGGCCACCTGATCCTCACCTGG + Intronic
1113908021 13:113829284-113829306 GAGGCCACCTGATCCTCACCTGG + Intronic
1113908149 13:113829788-113829810 GAGGCCACCTGATCCTCACCTGG + Intronic
1114303957 14:21403954-21403976 CAGGCCTCCGCCACCACACCTGG - Intronic
1115245968 14:31295387-31295409 CAGGCCTGCTCCCCCACACCAGG + Intronic
1115264633 14:31488308-31488330 CGGGCCTGGTGGTGCACACCTGG + Intergenic
1117684148 14:58236404-58236426 CAGGCATACAGGACCACACCTGG - Intronic
1118309593 14:64682606-64682628 AAGGCCTCCTTGTCTGCACCTGG + Intergenic
1118935344 14:70283001-70283023 CAGGTCTCATGTTCCTCACCTGG - Intergenic
1119572483 14:75687932-75687954 CATGCATCCTGGCCCACACTTGG - Intronic
1121515334 14:94545827-94545849 CAGGGCACCTAGGCCACACCAGG - Intergenic
1121618468 14:95330057-95330079 CTGAGCTCCTGGACCACACCAGG - Intergenic
1122809790 14:104282240-104282262 CAGGCCTCCTGGGGGGCACCTGG + Intergenic
1122870030 14:104634286-104634308 CAGGGCTCCTGGTCAGCCCCCGG - Intergenic
1122954916 14:105066096-105066118 CAGGGCTCCTGGGCCAGGCCAGG - Intergenic
1123061944 14:105598437-105598459 CTGGGCTCATAGTCCACACCAGG - Intergenic
1123086688 14:105720168-105720190 CTGGGCTCATAGTCCACACCAGG - Intergenic
1123734750 15:23174973-23174995 CTGGTCTCCTGCTCCTCACCTGG - Intergenic
1124223541 15:27870136-27870158 CAGGCCTGCTGCTCCAGCCCGGG + Intronic
1124285252 15:28396271-28396293 CTGGTCTCCTGCTCCTCACCTGG - Intergenic
1124297444 15:28515343-28515365 CTGGTCTCCTGCTCCTCACCTGG + Intergenic
1126351055 15:47745198-47745220 CAGGCTTCCTGGTACTCACCTGG + Intronic
1127604420 15:60572027-60572049 CAGGCCTCCCTGTCCTCATCTGG - Intronic
1128179913 15:65593120-65593142 CAGGCATGGTGGTGCACACCTGG + Intronic
1128217637 15:65945379-65945401 CAGGCCTGCAGCCCCACACCAGG - Intronic
1128551109 15:68598564-68598586 CAGGCATGCTGGTGCTCACCAGG - Intronic
1129171807 15:73812468-73812490 CAGGGCTAGTGGTCAACACCCGG - Intergenic
1129472561 15:75763604-75763626 CAGCCCTACTGGGCCAGACCAGG - Intergenic
1130672738 15:85927009-85927031 CTGGCTTCCTGGTCAACTCCTGG - Intergenic
1131121406 15:89825247-89825269 CAGGCCTCCTGCTCCCCATGGGG + Intergenic
1132829775 16:1921978-1922000 CATGGCGCCTGGCCCACACCTGG - Intergenic
1133218250 16:4306581-4306603 CAGGCCTTCTGCACCTCACCTGG + Intergenic
1133237174 16:4392762-4392784 CAGGGCATCTGGCCCACACCTGG - Intronic
1133333173 16:4988843-4988865 CAGGCAGCCTGGTCCACTGCTGG - Intronic
1133435167 16:5772975-5772997 AAGGCTTCCTGGAACACACCAGG - Intergenic
1134105777 16:11485186-11485208 CAGGCTCCCTGGTGCCCACCTGG + Intronic
1136020298 16:27435912-27435934 CAGGCATGGTGGTGCACACCTGG - Intronic
1136247303 16:28983336-28983358 CAGGCCTTCTGATCCAGCCCAGG - Intronic
1136288270 16:29257064-29257086 CTGGGCTCCTGGACCACAGCGGG - Intergenic
1137526361 16:49239866-49239888 CAGGCATGGTGGTGCACACCTGG + Intergenic
1138272214 16:55703373-55703395 CAAGACCCCTGGTCCACTCCAGG - Intronic
1138274905 16:55727273-55727295 CAGGCCTCATGGCCCCCACTAGG - Intergenic
1138533228 16:57646316-57646338 CAGGGCTCCAGCTCCAGACCTGG - Intronic
1138556157 16:57772346-57772368 CAGGCCTCCTGCCCAGCACCAGG + Intronic
1139781876 16:69358420-69358442 CAGGCATGGTGGTTCACACCTGG - Intronic
1141490385 16:84368525-84368547 CAAGCCTCCTGGGCCGGACCCGG - Exonic
1142080809 16:88147750-88147772 CTGGCCTCCTGGTCATCACAGGG + Intergenic
1142093941 16:88229819-88229841 CTGGGCTCCTGGACCACAGCGGG - Intergenic
1142112790 16:88341108-88341130 CAGGCCTTGTGGGCCACACGTGG + Intergenic
1142138269 16:88461279-88461301 CAAGCATCCTGGTCCTCACCAGG - Intronic
1142343415 16:89538479-89538501 CAGGGCTCCTCGTCCACCCGGGG - Intronic
1142375515 16:89704994-89705016 CAGGCATGGTGGTTCACACCTGG - Intergenic
1143620379 17:8076939-8076961 CAGGCATCATGGCCCTCACCTGG - Intronic
1144753944 17:17668343-17668365 CAGGCCTCCTGCTCCTGCCCTGG + Intergenic
1144997267 17:19278788-19278810 CAGGCATGGTGGTGCACACCTGG - Intronic
1145187380 17:20806739-20806761 CAGGCGTGCTGGTGCATACCAGG - Intergenic
1145293048 17:21565079-21565101 CAGGCCTCCTGGACCAGGGCGGG - Intronic
1146388370 17:32397937-32397959 CAGGCATGCTGCACCACACCTGG + Intergenic
1146550508 17:33776699-33776721 CAGGCCTCCGAGTCCAGACCAGG - Intronic
1146620228 17:34391424-34391446 CAGGGAACCTGGTCCTCACCTGG - Intergenic
1148493247 17:48037031-48037053 CAGTCCTCAAGGTCCACAGCTGG + Intronic
1148715330 17:49711536-49711558 CAGGTCTCCAGGTCCTGACCTGG - Exonic
1148785126 17:50142488-50142510 CATGCCACCTGGGCCACAACAGG + Intronic
1149495143 17:57112825-57112847 GAGGCCTCTTGGTCCCCACATGG + Intronic
1149555130 17:57568195-57568217 AATGCCTCTTGGTCCACACAAGG + Intronic
1150790031 17:68196176-68196198 CCGGGATCCTGGGCCACACCTGG - Intergenic
1151379735 17:73717465-73717487 CCTGCCTCCTGGACCCCACCTGG - Intergenic
1151775545 17:76198811-76198833 CAGGCCCCTTGGTCCAGGCCTGG + Intronic
1151897282 17:76988901-76988923 CAGGCCACATGGTGCAGACCTGG - Intergenic
1152643133 17:81457473-81457495 CAGGGCTGCTGCTGCACACCGGG + Exonic
1152828752 17:82484236-82484258 CAGGGCTCCTGCTGCACCCCAGG + Intronic
1153220084 18:2853699-2853721 CACTCCTCCCGCTCCACACCTGG + Intronic
1153546155 18:6207318-6207340 CAGGCCAACTGGTTCCCACCTGG + Intronic
1154015488 18:10612701-10612723 GAGGCCTCCTGGAGCACGCCGGG - Intergenic
1154190022 18:12222930-12222952 GAGGCCTCCTGGAGCACGCCGGG + Intergenic
1154405478 18:14086261-14086283 CAGGGCTGCTGGTCTCCACCTGG - Intronic
1155090216 18:22501517-22501539 CAGCCCTCCTTGTCAACACTTGG - Intergenic
1155295335 18:24379725-24379747 CAGGCCTCCCCTACCACACCTGG - Intronic
1158646662 18:59254628-59254650 CAGGCGTCCTCCACCACACCTGG + Intergenic
1160397505 18:78583269-78583291 CAGGCCTCCTGGGCCAGTCAGGG + Intergenic
1160696042 19:484963-484985 CAGGCCCCGTGGTGCCCACCTGG - Intergenic
1160707158 19:535056-535078 CGGCCCTCCTGGGCCACAGCAGG - Intronic
1160808090 19:1001238-1001260 GGGACCTCCTGGTCCCCACCCGG + Intronic
1161077859 19:2294955-2294977 CAGGCCCCGTGGCCCAAACCAGG + Intronic
1161537934 19:4831472-4831494 CAGGCCCCCTCCTCCGCACCGGG + Intronic
1162088601 19:8262925-8262947 CAGGCCTGGTGGCTCACACCTGG + Intronic
1163267114 19:16228017-16228039 CAGGGCTCTGGGCCCACACCTGG + Intronic
1163778220 19:19230542-19230564 CAGGCCTGTTGGTGCACACCTGG - Intronic
1163791165 19:19306810-19306832 CTGGTCTCCAGGTCCTCACCTGG - Intronic
1163972832 19:20816248-20816270 CAGGCATCTTGGTGCACACCTGG + Intronic
1164754528 19:30679872-30679894 CAGCCCACCTGGCCCACATCGGG + Intronic
1165287129 19:34851683-34851705 CAGACCACCTGGGACACACCTGG - Intergenic
1166633810 19:44431748-44431770 TAGGCCTCATGGTTCTCACCTGG + Intronic
1167614603 19:50525546-50525568 CAGGCGTCCTCCACCACACCCGG + Intronic
1168034664 19:53709848-53709870 CAGGCATCCTGGGACACACAGGG + Intergenic
1168144810 19:54415199-54415221 CAGCCCTCCTTGTCCATACGAGG - Intronic
1168701113 19:58440091-58440113 CAGGCCTCTGGAGCCACACCAGG - Exonic
924972574 2:142395-142417 CTGACCTCCTGATCCACCCCTGG - Intergenic
925761758 2:7191703-7191725 CAGGCATCATCTTCCACACCGGG + Intergenic
926146799 2:10401232-10401254 CAGGCATCCAGCACCACACCAGG + Intronic
926700015 2:15797339-15797361 CAGACCTCCAGGTCCGCACCAGG + Intergenic
926817258 2:16811557-16811579 CAGGTCTGGTGGTGCACACCTGG - Intergenic
927510776 2:23642625-23642647 CGGGCCACCTGCCCCACACCGGG - Exonic
927575773 2:24200873-24200895 CAGGGTTCCTGGTTCACAACAGG - Intergenic
928159185 2:28906331-28906353 CAGTGCTCCTGGCCCACACGTGG - Intronic
930751573 2:54939592-54939614 CATGCCTGCTGGTCCACAAGTGG - Intronic
932757249 2:74417363-74417385 CAGGGCTCATGGGCCTCACCTGG + Exonic
937262968 2:120598143-120598165 CAGGCCTCGTGGTCCACAATGGG - Intergenic
937979934 2:127608909-127608931 CAGGCTTCCCTGTCCCCACCCGG - Intronic
938097943 2:128475509-128475531 CAGGCCTCCTGGTACACAGTTGG + Intergenic
938408215 2:131044451-131044473 CGGGCTTCCTGGTGCACAGCAGG - Exonic
942539451 2:177000553-177000575 CAGGACACCTGGTCACCACCTGG - Intergenic
944370145 2:198973407-198973429 CAGGCTGCCTGGTACACAGCTGG + Intergenic
946765312 2:223035364-223035386 CAGGTCTCCTGTCCCACACTGGG - Intergenic
947672699 2:231948928-231948950 CAGGCATCCAGCACCACACCTGG + Intergenic
947716195 2:232340000-232340022 CAGGCCACCAGGGCCACCCCTGG - Intronic
947981778 2:234416634-234416656 GAGGGCTCCAGGGCCACACCTGG - Intergenic
948496409 2:238352553-238352575 CAGGCCTCCTGGTCCACACCTGG - Intronic
948829199 2:240589533-240589555 AAGGCCTCCTGGTACTCAGCAGG - Intronic
948922688 2:241073138-241073160 CAGGGAGCCTGGTCCCCACCAGG + Intronic
948922950 2:241074332-241074354 CAGTCCTCCTGGTGCTCACAGGG - Intronic
1172276764 20:33684374-33684396 CAGGCCACCTGGCCCACCCCTGG + Intronic
1172385944 20:34534316-34534338 CAGGCCTGCTGGCTCACTCCTGG - Intronic
1172480657 20:35269503-35269525 CACACCTCCTTTTCCACACCAGG + Intronic
1172658535 20:36550870-36550892 CAGGCCTCCAGCTACACACACGG + Exonic
1173318226 20:41964006-41964028 CAGGCCTGCGCTTCCACACCCGG + Intergenic
1173866268 20:46314322-46314344 CAGCCCTCCTGGTGCTCAGCAGG - Intergenic
1174674539 20:52340885-52340907 CAGGCCCCCGGCACCACACCCGG + Intergenic
1176026712 20:62989730-62989752 CAGTCCTCCATGTCCACGCCAGG - Intergenic
1176054437 20:63136383-63136405 CAGGGCTCCTGCCCCCCACCTGG - Intergenic
1176383074 21:6123048-6123070 CTGGCCTGCTGGTGCCCACCGGG + Exonic
1178576555 21:33797587-33797609 CAGGCACCCTGGTCCACTGCAGG + Exonic
1179078667 21:38149053-38149075 CCAGCCTGCTGGTCCACACTGGG + Intronic
1179142708 21:38741050-38741072 CAGGCCTCTAATTCCACACCTGG + Intergenic
1179740395 21:43415191-43415213 CTGGCCTGCTGGTGCCCACCGGG - Exonic
1179992155 21:44953676-44953698 CTGGCCTCCTGAGCCACACCTGG - Intronic
1180037270 21:45256362-45256384 CAGGCCCCCTGCTCCACCTCGGG - Intergenic
1180608318 22:17078516-17078538 CAGGCATGGTGGTGCACACCTGG + Intergenic
1181009973 22:20034552-20034574 CAGCCGTCCAGGTCCACACTGGG - Intronic
1181027930 22:20136243-20136265 CAGACCTGATGGTGCACACCAGG - Intronic
1181067839 22:20315093-20315115 CAGGCCTGCTGTGCCACACAGGG - Intronic
1181394125 22:22606371-22606393 CAGGCCCAGTGGTTCACACCTGG - Intergenic
1182618962 22:31607873-31607895 CTGGCTTCCGGGTCCACCCCAGG - Intronic
1184471494 22:44698604-44698626 AAGGCCTCCAGGTGCCCACCGGG - Intronic
1184652587 22:45925917-45925939 CAGCCATCCTGGGCCACAGCAGG - Intronic
1184804016 22:46780745-46780767 CTGGGCACCTGCTCCACACCAGG - Intronic
1184930082 22:47674522-47674544 GAGGCCTCCTGGTTCAGACAGGG + Intergenic
1185055723 22:48577370-48577392 CAGGGCTCCCGGTGCACCCCGGG + Intronic
950672857 3:14537663-14537685 CTGGCCTCCTACTCCACAGCAGG - Intronic
950685598 3:14616494-14616516 CAGGCCTCCTTGTCATCACAGGG - Intergenic
952845267 3:37682929-37682951 CAGGCCCCCTGTTCCTCTCCTGG + Intronic
953235681 3:41104119-41104141 CAGGCTTGCTGGTCCACTGCTGG - Intergenic
953392355 3:42540866-42540888 CAGCCCTCCTCCTCCCCACCTGG - Intergenic
954139087 3:48595743-48595765 TGGGCCTCCTGGGCCCCACCCGG + Intergenic
954273083 3:49524530-49524552 CAGGCCTGGTTGTACACACCTGG + Intronic
955751610 3:62189687-62189709 CAGGCCCCCTCCTCCACACTTGG + Intronic
956392740 3:68791062-68791084 CAAGCCACCTGGTCCACAAAAGG + Intronic
958748489 3:98165817-98165839 CTGGCCTCCTTGAACACACCTGG + Intergenic
958818625 3:98947105-98947127 CATACCTCCTGCTCCATACCAGG - Intergenic
961088947 3:124093277-124093299 CAGGCCTCCTGGTCTCCATCAGG - Intronic
961263915 3:125624945-125624967 CAGGCATAATGGTTCACACCTGG + Intergenic
961318486 3:126056612-126056634 CTCTCCTCCTGGCCCACACCAGG + Intronic
961452910 3:127010506-127010528 CTGGCTGCCTGGGCCACACCCGG - Intronic
961642278 3:128371957-128371979 CTGCACTCCTGGTCCGCACCAGG - Intronic
964629850 3:158798563-158798585 CAGGCACCGTGGTTCACACCTGG - Intronic
965600624 3:170451102-170451124 CAGGCGCCCTGCACCACACCTGG + Intronic
966112363 3:176418491-176418513 CAGGCCTCCTGTATGACACCAGG - Intergenic
968574773 4:1360493-1360515 CCGGCCTCCTTGTCCAGGCCTGG + Intronic
973123778 4:46558068-46558090 CAGGCGTCCACGACCACACCTGG + Intergenic
976258576 4:83124495-83124517 CAGGCATCCGCCTCCACACCCGG - Intronic
983224798 4:165075710-165075732 CAGGCACCCTGCACCACACCTGG + Exonic
985785218 5:1889762-1889784 CAGGCCTCCTGGCCAAGACCTGG - Intergenic
987351978 5:17030220-17030242 CAGGCGTCCGTGACCACACCCGG + Intergenic
988581003 5:32468823-32468845 GAGGACTCCTGGCCCAGACCAGG + Intergenic
990176081 5:53109889-53109911 CAGGCGGCCTGTTCCACGCCAGG + Intronic
994158818 5:96532571-96532593 CAGGCATCGTGGCCCACACCTGG + Intronic
995022531 5:107382512-107382534 CAGGCATCGTGGTTCACACCTGG - Intronic
996832442 5:127754887-127754909 CAGGCCACCTGGGGCAGACCAGG - Intergenic
997498142 5:134348109-134348131 CAGGCCTGGTGGCTCACACCTGG + Intronic
998372783 5:141672060-141672082 CAGCCCTCCTGTTCCCCACATGG + Intronic
998460609 5:142307327-142307349 CAGGCCTTCTGGAGCCCACCTGG - Intergenic
1000431990 5:161163328-161163350 CAGGCGTGGTGGTGCACACCTGG - Intergenic
1000604700 5:163315614-163315636 GAAGCCTACTGGTCCACACACGG - Intergenic
1001051545 5:168418343-168418365 CAGGCTCCCTGGCCCACCCCAGG + Intronic
1002271706 5:178076690-178076712 CAGGCATGGTGGTGCACACCTGG + Intergenic
1002347948 5:178561156-178561178 AAGGCCACCCCGTCCACACCCGG + Intronic
1002476974 5:179472565-179472587 CAAGGCACCTGGTACACACCTGG - Intergenic
1003965636 6:11249887-11249909 CTGCCCTCCTGGTACACACGTGG + Intronic
1005357561 6:24999188-24999210 CAGTCAGCTTGGTCCACACCTGG - Intronic
1005939347 6:30549138-30549160 CAGGCGTGCGGCTCCACACCTGG + Intronic
1006474493 6:34245638-34245660 CAGGGCTCTTGGGCCTCACCTGG - Exonic
1007913225 6:45536510-45536532 CAGGGCTGTTGGACCACACCTGG + Intronic
1008239689 6:49094358-49094380 CAGGACTCTTGGTCCAAACATGG - Intergenic
1011612624 6:89168258-89168280 CAGGCATGGTGGTGCACACCTGG - Intergenic
1012937872 6:105387068-105387090 CAGGCATCCGCCTCCACACCTGG - Intronic
1013232104 6:108168462-108168484 CCTGCCTCCTAGTCCACAGCGGG - Intronic
1013360923 6:109393358-109393380 CAGGCCTAGTGGCACACACCTGG - Intronic
1017652932 6:156599539-156599561 CAGGGCAACTGGCCCACACCGGG + Intergenic
1018303106 6:162424591-162424613 CAGGCCCCCATGACCACACCCGG - Intronic
1019117409 6:169776408-169776430 CAGGCATCATGATCCTCACCTGG - Intronic
1019265627 7:116084-116106 CAGGCCTCCATGTCCAGAGCAGG - Intergenic
1019325396 7:435978-436000 CGGGGCTGCTGTTCCACACCCGG - Intergenic
1019408941 7:898332-898354 CTGTGCTCCTGGTCCTCACCTGG - Exonic
1022537543 7:31107243-31107265 CAGGCCTCCTGGCACTCGCCTGG + Exonic
1025089958 7:56053609-56053631 CAGGCGTGCAGGACCACACCCGG - Intronic
1026117513 7:67508482-67508504 CAGGCCTCCTGGTCCTAACATGG - Intergenic
1027365955 7:77458233-77458255 CTGGCCTCCTTGACCGCACCAGG - Intergenic
1027672476 7:81118894-81118916 CAGCCTGCCTGGGCCACACCTGG + Intergenic
1029261068 7:99303235-99303257 CAGGCAGCCTGGTCCTCAGCAGG - Intergenic
1030334281 7:108307764-108307786 CTGGCCTCCTGCTCCACACTGGG + Intronic
1031560640 7:123233882-123233904 CAGGCTTCCTGGTCCACACCAGG - Intergenic
1033284070 7:140025982-140026004 CAGGCCACCCTGCCCACACCTGG + Intronic
1034059207 7:148070573-148070595 CAGGCATGGTGGTGCACACCTGG + Intronic
1034265768 7:149779966-149779988 CAGGCCTCGTGGTACTCAGCAGG - Intergenic
1034500922 7:151450268-151450290 GCGGCCTCCTGGTCCAAAGCTGG + Intergenic
1034829531 7:154297388-154297410 CAGGGCTCATGGGCCAAACCTGG - Intronic
1036125318 8:6056948-6056970 CAGGCATCCGCGACCACACCTGG + Intergenic
1036465990 8:8997733-8997755 CAGGCTTGGTGGTGCACACCTGG - Intergenic
1036642556 8:10593272-10593294 AAGGTCTCCTGGTCCCCACCCGG - Intergenic
1036780422 8:11643017-11643039 CACTCCTCCTGGTCCAAACGAGG + Intergenic
1037892935 8:22633408-22633430 CAGTCAGCCTGGCCCACACCAGG + Intronic
1038275250 8:26115897-26115919 CAGGCCACCTGTTCCTCACTAGG + Intergenic
1039050885 8:33492149-33492171 CAGGCATGGTGGTGCACACCTGG - Intronic
1040311825 8:46240734-46240756 CAGCCCACCTGGGACACACCTGG - Intergenic
1040461582 8:47654089-47654111 CATGCCTCTTGGTACACACATGG - Intronic
1040705985 8:50127594-50127616 GAAGCCTCCTGGTCTAGACCGGG + Intronic
1041024039 8:53666043-53666065 CAGTCCTGCTGCCCCACACCTGG - Intergenic
1041667246 8:60457714-60457736 CAGGCGTCCATGACCACACCTGG + Intergenic
1041781798 8:61585234-61585256 CAGTCCTGCTGGTGCACAACTGG + Intronic
1043419417 8:80083771-80083793 CAGGCCGACTAGTCCACAACAGG - Intronic
1045505902 8:102778375-102778397 CAGGCCTGCAGCACCACACCTGG - Intergenic
1045823721 8:106372119-106372141 CAGGCCTACTGTTCCAACCCTGG - Intronic
1047024846 8:120813187-120813209 CAGGTCTCATGGTCCACTCAAGG + Exonic
1047973488 8:130107323-130107345 CAGGCGTCCTCCACCACACCCGG + Intronic
1048244216 8:132775672-132775694 CAGGCCGCCTGGCCCCCGCCGGG + Intronic
1048878633 8:138855915-138855937 AAGGCCTCCTCTTCCACAGCAGG - Intronic
1049365591 8:142235349-142235371 GAGGCCTCCTCGTCCCCACCTGG + Intronic
1051165718 9:14260245-14260267 CTGGTCTCCTGGTCCACCCCAGG + Intronic
1052803294 9:32989944-32989966 GAGTCCTCCAGGGCCACACCCGG + Intronic
1052866703 9:33468469-33468491 CAGGCCTCCTGGCATAGACCTGG + Intronic
1053684253 9:40506696-40506718 CAGGAGTCATGGTACACACCTGG + Intergenic
1054279471 9:63118257-63118279 CAGGAGTCATGGTACACACCTGG - Intergenic
1054297347 9:63342160-63342182 CAGGAGTCATGGTACACACCTGG + Intergenic
1054395367 9:64646668-64646690 CAGGAGTCATGGTACACACCTGG + Intergenic
1054430014 9:65151868-65151890 CAGGAGTCATGGTACACACCTGG + Intergenic
1054500371 9:65869664-65869686 CAGGAGTCATGGTACACACCTGG - Intergenic
1055429229 9:76227134-76227156 GAGGTCTCCTGGTCCACAGAGGG - Intronic
1056731381 9:89169255-89169277 CAGGCCTCCTAGTCCTCAGGTGG - Intronic
1057177911 9:93012866-93012888 CAGCCCTCTTAGTGCACACCAGG + Intronic
1058567535 9:106302576-106302598 AAGGCCTGGAGGTCCACACCAGG + Intergenic
1058835087 9:108853561-108853583 CAGGTCTCCTGATCCACATCAGG - Intergenic
1059310522 9:113385853-113385875 CAGGCCACATGGTCCACTCTTGG - Intergenic
1059456984 9:114406029-114406051 CAGTCCTCCTGGTGAACACAGGG + Intronic
1059636825 9:116179575-116179597 CATCCCTCCGGGTCCACCCCGGG - Intronic
1060732932 9:126049495-126049517 CAGGGGTCATGATCCACACCTGG + Intergenic
1062030575 9:134360153-134360175 CAGGGATCCTGGCCCACCCCAGG - Intronic
1062034254 9:134375757-134375779 CAGCCCTCCTACTCCGCACCAGG - Intronic
1062042485 9:134410543-134410565 CAAGCCTCCCTGCCCACACCAGG - Intronic
1062533835 9:137013034-137013056 CAGGCCTGCAGGTCCTCATCCGG + Exonic
1062553957 9:137105593-137105615 CAGGCGTCCTGGCCCACAGAGGG - Intronic
1062590840 9:137273923-137273945 CTCACCTCCTGGTGCACACCAGG + Intergenic
1062644503 9:137540586-137540608 CAGGCCTCCGGGGCCAACCCAGG + Intronic
1203780971 EBV:100721-100743 CGGGCCTCACGGCCCACACCTGG - Intergenic
1186546724 X:10457709-10457731 AAAGCCTCCTGGGCCACACCAGG - Intronic
1187137826 X:16565358-16565380 CAGGCATGGTGGTACACACCTGG + Intergenic
1188025007 X:25199134-25199156 CAGGCCGCCTGGATCACAACAGG + Intergenic
1188642358 X:32521977-32521999 CAGGCTTCCTGGTTCATACTTGG - Intronic
1189270886 X:39751143-39751165 CAGGGATCTTGGGCCACACCTGG + Intergenic
1189833873 X:45001442-45001464 CAAGACTCCTGGTTGACACCGGG + Intronic
1191659618 X:63636115-63636137 TATGCCTCCTGATCCAGACCAGG - Exonic
1192632089 X:72785064-72785086 CTGGCCTCCTGGGCCAGCCCGGG - Intronic
1192649620 X:72935737-72935759 CTGGCCTCCTGGGCCAGCCCGGG + Intronic
1198084124 X:133266651-133266673 CAGGCCTCCGCCACCACACCTGG + Intergenic
1198742471 X:139855850-139855872 CAAGCCTCCTGGTTGACACTGGG - Intronic
1200319962 X:155177576-155177598 CAGGCCTCCTGGCAAAAACCTGG + Intergenic