ID: 948501785

View in Genome Browser
Species Human (GRCh38)
Location 2:238399745-238399767
Sequence CGGTATGCACACCCATGCAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948501785_948501790 23 Left 948501785 2:238399745-238399767 CCTTTGCATGGGTGTGCATACCG 0: 1
1: 0
2: 0
3: 2
4: 68
Right 948501790 2:238399791-238399813 CAACATAAGGAAGACTTAAAAGG 0: 1
1: 0
2: 2
3: 21
4: 312
948501785_948501787 -5 Left 948501785 2:238399745-238399767 CCTTTGCATGGGTGTGCATACCG 0: 1
1: 0
2: 0
3: 2
4: 68
Right 948501787 2:238399763-238399785 TACCGAGAGACAGGCAGCTTAGG 0: 1
1: 0
2: 1
3: 7
4: 93
948501785_948501789 10 Left 948501785 2:238399745-238399767 CCTTTGCATGGGTGTGCATACCG 0: 1
1: 0
2: 0
3: 2
4: 68
Right 948501789 2:238399778-238399800 AGCTTAGGAAAAACAACATAAGG 0: 1
1: 0
2: 2
3: 27
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948501785 Original CRISPR CGGTATGCACACCCATGCAA AGG (reversed) Exonic
900078265 1:835381-835403 CGGATTGCACACCCAGGTAATGG + Intergenic
902125773 1:14209777-14209799 GGCTATGTATACCCATGCAAAGG + Intergenic
906718822 1:47990700-47990722 TGGTATGCCCATCCATCCAATGG - Intronic
917941682 1:179928344-179928366 TGGTATCAACACCCATGGAAAGG - Intergenic
918188433 1:182148343-182148365 TGTTACTCACACCCATGCAAGGG - Intergenic
918479787 1:184966142-184966164 AGGCATGAACACCTATGCAAGGG - Intronic
918691595 1:187487539-187487561 CGGTAGGCACACCGTTGCATCGG - Intergenic
922090975 1:222394756-222394778 TGGCATCAACACCCATGCAAAGG - Intergenic
1065635831 10:27732889-27732911 AGGTATGCACCACCATGCATGGG + Intronic
1066567839 10:36738871-36738893 CTGTATGCACACATATGCAGGGG - Intergenic
1066738413 10:38499221-38499243 CGGAATGGACTCCCATGGAATGG + Intergenic
1073716203 10:106110302-106110324 AGTTATGCATGCCCATGCAAAGG + Intergenic
1077314363 11:1910830-1910852 TGGTCAGCACACCCATGAAAGGG - Intergenic
1102205966 12:111091116-111091138 CCGTGTGCACATCCATGTAAGGG + Intronic
1103933310 12:124462091-124462113 AAGTATGCACAGCCATCCAAAGG + Intronic
1105532740 13:21234886-21234908 CTGTATGCACATCTCTGCAAAGG - Intergenic
1114006121 14:18314974-18314996 CTGTATGCACACATATGCAGGGG - Intergenic
1121931847 14:97979295-97979317 GGGCATGCACACCAATGCATGGG - Intergenic
1123114309 14:105886963-105886985 CAAGATGCACACCCATGCACAGG - Intergenic
1123922181 15:25077966-25077988 CAGTATGTACAACCATGGAAGGG - Intergenic
1125759484 15:42087241-42087263 CGGGCTGGACCCCCATGCAAGGG - Intronic
1128796335 15:70469422-70469444 CACTATGCACTCCCATGCCATGG + Intergenic
1129152807 15:73699660-73699682 CCACATGCACACCCATGCCAGGG - Exonic
1129432923 15:75514235-75514257 TGGTAACCACACCCATGAAAAGG + Intronic
1135860977 16:26055710-26055732 CCATATGCACCCACATGCAATGG - Intronic
1139586755 16:67908918-67908940 CAGTATGCACACCCCTGCCCCGG + Exonic
1140257697 16:73350946-73350968 CGGGATCCAAACCCATGCACCGG + Intergenic
1140899890 16:79357865-79357887 AGGTCAGCAGACCCATGCAAGGG - Intergenic
1141513409 16:84526999-84527021 CGGTCAGCACAACCAGGCAAGGG + Intronic
1141515118 16:84538840-84538862 CACTAAGCACAACCATGCAATGG - Intronic
1142187868 16:88703003-88703025 TGGCGTGCACACCCATGGAAAGG + Intronic
1142211592 16:88811158-88811180 CGGAATGCCCACCCAGGGAAGGG - Intronic
1144639285 17:16928625-16928647 CAGCATGGACACCCAAGCAAGGG - Intergenic
1152555960 17:81053444-81053466 CGGTTTTCACACCTGTGCAAAGG - Intronic
1154531355 18:15349207-15349229 CTGTATGCACACATATGCAGGGG + Intergenic
1159117995 18:64136946-64136968 CGCTATGCAACCCAATGCAATGG - Intergenic
928360114 2:30655871-30655893 CTGTGTGCAGACCCAGGCAAAGG + Intergenic
929609509 2:43259647-43259669 CAGTATGAACCCACATGCAAAGG - Intronic
930584647 2:53254826-53254848 AGGCATGCACCACCATGCAAAGG - Intergenic
934560843 2:95312551-95312573 CGGTAAACACATCCATGCAGGGG - Intronic
938530453 2:132180487-132180509 CTGTATGCACACATATGCAGGGG + Intronic
948501785 2:238399745-238399767 CGGTATGCACACCCATGCAAAGG - Exonic
1171018308 20:21561621-21561643 CAGTAGGCACACCCACGCCAGGG - Intergenic
1172778355 20:37421203-37421225 AGGTATGCACACCTGTGCATGGG - Intergenic
1173793644 20:45843801-45843823 CAGTCTGCACACCCATGCACGGG - Intronic
1174490698 20:50892697-50892719 TGGTATACACACCAAGGCAATGG + Exonic
1176766001 21:13018944-13018966 CTGTATGCACACATATGCAGGGG - Intergenic
1180430631 22:15245781-15245803 CTGTATGCACACATATGCAGGGG - Intergenic
1181645667 22:24230713-24230735 CGGTAGGAATACCCATGCTAGGG - Intronic
1181747915 22:24968522-24968544 CAGCATCCACACCCATGGAATGG + Intronic
1184657827 22:45950713-45950735 CAGTTTCCACACCCATGAAATGG + Intronic
961280578 3:125763374-125763396 CGCTCTGCACAGCCGTGCAAGGG + Intergenic
990855963 5:60266630-60266652 CAGTATGCACACCCATGTTTGGG - Intronic
999134125 5:149306476-149306498 TGGTGGGCACACCCATGCTAAGG - Intronic
1000157436 5:158565551-158565573 GGGTATACACACTCTTGCAACGG + Intergenic
1004135928 6:12966423-12966445 GGGAATGCAAACCCAGGCAAGGG + Intronic
1006411652 6:33877433-33877455 CTGCATGCACACGCATGCAGTGG + Intergenic
1012024057 6:93965739-93965761 CGCTATGCATCCCTATGCAAGGG - Intergenic
1015923373 6:138287226-138287248 CAGTATGCACACACCTGCACAGG + Intronic
1021238225 7:18169759-18169781 CTGTATCCATATCCATGCAAAGG + Intronic
1025994272 7:66518385-66518407 CAGTCTGCACATCCCTGCAATGG - Intergenic
1026033727 7:66816280-66816302 CGGTCTGCACATCCCTGCAATGG + Intergenic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035649009 8:1250317-1250339 CGGTGTGCAGACCCAGGCACTGG - Intergenic
1035767641 8:2119813-2119835 AGGTCAGCACAGCCATGCAAGGG + Intronic
1053340543 9:37323502-37323524 CGGTATGGAAAGCCATGCATTGG - Intronic
1053709063 9:40786975-40786997 CTGTATGCACACATATGCAGGGG + Intergenic
1054418972 9:64907776-64907798 CTGTATGCACACATATGCAGGGG + Intergenic
1055159708 9:73110725-73110747 CTGTATGCTCACCTATGAAATGG + Intergenic
1190761902 X:53443954-53443976 AGGTATGCAGACCACTGCAATGG + Intergenic
1196010409 X:110880956-110880978 CTGTGTGCACACCCATGCCCTGG + Intergenic