ID: 948504972

View in Genome Browser
Species Human (GRCh38)
Location 2:238422508-238422530
Sequence CCCGCTTTCCGCCCCGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948504972_948504982 0 Left 948504972 2:238422508-238422530 CCAGCTGCGGGGCGGAAAGCGGG No data
Right 948504982 2:238422531-238422553 GGTGCGGTGGGGGAGGCATCTGG No data
948504972_948504991 28 Left 948504972 2:238422508-238422530 CCAGCTGCGGGGCGGAAAGCGGG No data
Right 948504991 2:238422559-238422581 GGGAGAGGTCCCCAGGACAGGGG No data
948504972_948504980 -10 Left 948504972 2:238422508-238422530 CCAGCTGCGGGGCGGAAAGCGGG No data
Right 948504980 2:238422521-238422543 GGAAAGCGGGGGTGCGGTGGGGG No data
948504972_948504985 7 Left 948504972 2:238422508-238422530 CCAGCTGCGGGGCGGAAAGCGGG No data
Right 948504985 2:238422538-238422560 TGGGGGAGGCATCTGGTGAGGGG No data
948504972_948504983 5 Left 948504972 2:238422508-238422530 CCAGCTGCGGGGCGGAAAGCGGG No data
Right 948504983 2:238422536-238422558 GGTGGGGGAGGCATCTGGTGAGG No data
948504972_948504989 26 Left 948504972 2:238422508-238422530 CCAGCTGCGGGGCGGAAAGCGGG No data
Right 948504989 2:238422557-238422579 GGGGGAGAGGTCCCCAGGACAGG No data
948504972_948504988 21 Left 948504972 2:238422508-238422530 CCAGCTGCGGGGCGGAAAGCGGG No data
Right 948504988 2:238422552-238422574 GGTGAGGGGGAGAGGTCCCCAGG No data
948504972_948504981 -7 Left 948504972 2:238422508-238422530 CCAGCTGCGGGGCGGAAAGCGGG No data
Right 948504981 2:238422524-238422546 AAGCGGGGGTGCGGTGGGGGAGG No data
948504972_948504984 6 Left 948504972 2:238422508-238422530 CCAGCTGCGGGGCGGAAAGCGGG No data
Right 948504984 2:238422537-238422559 GTGGGGGAGGCATCTGGTGAGGG No data
948504972_948504990 27 Left 948504972 2:238422508-238422530 CCAGCTGCGGGGCGGAAAGCGGG No data
Right 948504990 2:238422558-238422580 GGGGAGAGGTCCCCAGGACAGGG No data
948504972_948504986 8 Left 948504972 2:238422508-238422530 CCAGCTGCGGGGCGGAAAGCGGG No data
Right 948504986 2:238422539-238422561 GGGGGAGGCATCTGGTGAGGGGG No data
948504972_948504987 13 Left 948504972 2:238422508-238422530 CCAGCTGCGGGGCGGAAAGCGGG No data
Right 948504987 2:238422544-238422566 AGGCATCTGGTGAGGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948504972 Original CRISPR CCCGCTTTCCGCCCCGCAGC TGG (reversed) Intergenic
No off target data available for this crispr