ID: 948505355

View in Genome Browser
Species Human (GRCh38)
Location 2:238424153-238424175
Sequence GGTGAGGATCCTGCTGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948505355_948505358 -8 Left 948505355 2:238424153-238424175 CCAGGCCCAGCAGGATCCTCACC No data
Right 948505358 2:238424168-238424190 TCCTCACCAGCCTGCAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948505355 Original CRISPR GGTGAGGATCCTGCTGGGCC TGG (reversed) Intergenic
No off target data available for this crispr