ID: 948505449

View in Genome Browser
Species Human (GRCh38)
Location 2:238424596-238424618
Sequence GTGGGCTGTCTTGCCCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 165}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948505449_948505456 10 Left 948505449 2:238424596-238424618 CCTGGAGGGGCAAGACAGCCCAC 0: 1
1: 0
2: 1
3: 19
4: 165
Right 948505456 2:238424629-238424651 CTGTTGCTGCTGTGCTGGGCTGG 0: 1
1: 0
2: 5
3: 49
4: 491
948505449_948505457 11 Left 948505449 2:238424596-238424618 CCTGGAGGGGCAAGACAGCCCAC 0: 1
1: 0
2: 1
3: 19
4: 165
Right 948505457 2:238424630-238424652 TGTTGCTGCTGTGCTGGGCTGGG 0: 1
1: 1
2: 11
3: 81
4: 510
948505449_948505460 25 Left 948505449 2:238424596-238424618 CCTGGAGGGGCAAGACAGCCCAC 0: 1
1: 0
2: 1
3: 19
4: 165
Right 948505460 2:238424644-238424666 TGGGCTGGGATGGCACTGGTAGG 0: 1
1: 1
2: 3
3: 32
4: 397
948505449_948505459 21 Left 948505449 2:238424596-238424618 CCTGGAGGGGCAAGACAGCCCAC 0: 1
1: 0
2: 1
3: 19
4: 165
Right 948505459 2:238424640-238424662 GTGCTGGGCTGGGATGGCACTGG 0: 1
1: 0
2: 3
3: 55
4: 445
948505449_948505453 5 Left 948505449 2:238424596-238424618 CCTGGAGGGGCAAGACAGCCCAC 0: 1
1: 0
2: 1
3: 19
4: 165
Right 948505453 2:238424624-238424646 TGGTCCTGTTGCTGCTGTGCTGG 0: 1
1: 0
2: 1
3: 25
4: 280
948505449_948505454 6 Left 948505449 2:238424596-238424618 CCTGGAGGGGCAAGACAGCCCAC 0: 1
1: 0
2: 1
3: 19
4: 165
Right 948505454 2:238424625-238424647 GGTCCTGTTGCTGCTGTGCTGGG 0: 1
1: 0
2: 0
3: 22
4: 294
948505449_948505458 15 Left 948505449 2:238424596-238424618 CCTGGAGGGGCAAGACAGCCCAC 0: 1
1: 0
2: 1
3: 19
4: 165
Right 948505458 2:238424634-238424656 GCTGCTGTGCTGGGCTGGGATGG 0: 1
1: 0
2: 11
3: 101
4: 894

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948505449 Original CRISPR GTGGGCTGTCTTGCCCCTCC AGG (reversed) Intergenic
900608317 1:3533651-3533673 GTGGCCGGTCGTGCACCTCCTGG - Intronic
901988278 1:13092603-13092625 CTGGGCTTTCTTGCCCCTTCCGG + Intergenic
901993534 1:13134164-13134186 CTGGGCTTTCTTGCCCCTTCCGG - Intergenic
902051547 1:13567502-13567524 GGGGGGTGTCTTGCCTGTCCTGG - Intergenic
904576092 1:31505900-31505922 GTGGGCTGCCCTTCCCCTCATGG - Intergenic
907223982 1:52927753-52927775 GTGGGCTGGCTTGCCCCGGAGGG + Intronic
907314690 1:53560834-53560856 GTGTGGTGTATTGCCCCTTCAGG - Intronic
907950376 1:59177920-59177942 GTTGCCTGTCTGGCCCCTCCAGG - Intergenic
908913915 1:69104184-69104206 GTGGGCTGTGTTGCCTATTCTGG - Intergenic
910392875 1:86762711-86762733 GTGGTCTGTCCTGCCCATCCCGG + Intergenic
915981223 1:160420989-160421011 GTGGCCTCTCTTCCCACTCCAGG - Intronic
916533602 1:165681928-165681950 CTGCCCTGTCTTGCCCCTCAAGG - Intronic
917240638 1:172944790-172944812 GTTGGCTGTCTGGTCCCTCTTGG + Intergenic
922694240 1:227720089-227720111 ATGGGGTGTCTTGCCTGTCCTGG + Intergenic
922806836 1:228394658-228394680 GTTGCCTCTCCTGCCCCTCCAGG - Exonic
922937032 1:229431030-229431052 GTGGCCTGACTTGACCCTCTGGG - Intergenic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1063388685 10:5634234-5634256 GAGAGCTGCCTTGCCCCTTCAGG - Intergenic
1066803034 10:39210760-39210782 GTTGGCTGTCATGCCCACCCTGG - Intergenic
1068830133 10:61484563-61484585 TTGAGATGTCCTGCCCCTCCAGG - Intergenic
1069794493 10:71043441-71043463 GTGGGAGGTCTTGCTCCTGCTGG + Intergenic
1069830968 10:71282260-71282282 GGGGGCTGTTCTGCCTCTCCTGG - Intronic
1070815938 10:79323288-79323310 CTGGTCTGTCTTGCCTCTCAGGG - Intergenic
1074159017 10:110821862-110821884 GGGGGCTGGCTTTCTCCTCCAGG - Exonic
1075697476 10:124447592-124447614 GGGGGCAGTCCTGGCCCTCCCGG - Exonic
1076320626 10:129578708-129578730 GTGGACTGTCTTTCACATCCTGG + Intronic
1076669168 10:132110180-132110202 GGGGGCTGCCTGTCCCCTCCAGG - Intronic
1077151668 11:1075594-1075616 TTGGGCAGCCTTCCCCCTCCGGG + Intergenic
1078080143 11:8198200-8198222 ATGGGATGTCTTCCCCATCCGGG + Intergenic
1078455395 11:11470869-11470891 GTGGGATGTTTTCCCCCTCCAGG + Intronic
1088711955 11:112516309-112516331 GTGGGCTCTTTTGCCCAGCCTGG - Intergenic
1089302953 11:117509582-117509604 CTGGGCTCTCTTCCCCCTCCAGG - Intronic
1089518281 11:119047522-119047544 ATGGGCTTTTTTGCTCCTCCAGG + Intronic
1096796495 12:54081295-54081317 GAGGCCTGACTCGCCCCTCCAGG - Intergenic
1100394389 12:94171890-94171912 TTGAGCTGACTTGCCCCACCAGG + Intronic
1100690621 12:97035121-97035143 CTGGCCTGTCTTCCCTCTCCAGG - Intergenic
1104267538 12:127249320-127249342 GTGTGCTGTCTCGCTCCTGCTGG + Intergenic
1104928990 12:132328607-132328629 GGGGGCTGGCTTGGCGCTCCAGG - Intronic
1105782728 13:23718184-23718206 GTGAGCTGTCTGGCCCCACAGGG + Intergenic
1111134713 13:84026062-84026084 GTGGGCTTTCTTTCCCCTGCTGG + Intergenic
1112733578 13:102394261-102394283 GGTGGCTGCCTTGGCCCTCCCGG - Intronic
1119420671 14:74506060-74506082 GTGGGCGGCAGTGCCCCTCCTGG + Exonic
1119705947 14:76782626-76782648 GTGGGCAGTCTGCCCCCGCCAGG + Exonic
1121516808 14:94557743-94557765 GTGGGCTGTTTAGCCTCTCTAGG - Intergenic
1122068660 14:99191138-99191160 GAGGGTTGTTTTGCCCCTCCAGG + Intronic
1122090439 14:99334957-99334979 GTGGGCAGTTTTGCTCCTGCTGG - Intergenic
1122271022 14:100568519-100568541 TGGGCCTGGCTTGCCCCTCCCGG + Intronic
1122811004 14:104287856-104287878 GTGGGCTGTCTTGGTCCACAAGG - Intergenic
1123476517 15:20595325-20595347 GTGGGCTTTCCCACCCCTCCAGG + Intergenic
1123641494 15:22405039-22405061 GTGGGCTTTCCCACCCCTCCAGG - Intergenic
1124688290 15:31800517-31800539 GTTGGCTCTCCTGTCCCTCCTGG - Intronic
1125768957 15:42152771-42152793 GTGGGCTGTCTGGCTCCTACAGG - Intronic
1128390321 15:67178294-67178316 GTGGGCTGGGTTGCCGTTCCTGG + Intronic
1129248981 15:74297852-74297874 GTTGGCTGGTTGGCCCCTCCGGG - Intronic
1130555310 15:84918435-84918457 GTGGGCTGTCTGGGGTCTCCTGG + Intronic
1130837197 15:87662858-87662880 GTGAGCCATCGTGCCCCTCCTGG - Intergenic
1131268169 15:90930989-90931011 GTGGGATCTCTGGCCCCTCAGGG - Exonic
1131521127 15:93116520-93116542 GTGGGCTGTCTCCTCCCTCCTGG - Intergenic
1132085836 15:98907691-98907713 GTCTGCTTTCTTGCCTCTCCAGG + Intronic
1132099108 15:99010380-99010402 GTGTGCTGGCTGGCCCCTGCTGG - Intergenic
1132250326 15:100331117-100331139 GTGGTCTTGCCTGCCCCTCCGGG - Intronic
1132400701 15:101503195-101503217 AGGGGCTGCCTTTCCCCTCCAGG + Intronic
1133394507 16:5435461-5435483 GTGGGCTGTTTTTTCCCTTCAGG - Intergenic
1141625949 16:85261116-85261138 CTGGGCAGCCTTGGCCCTCCAGG - Intergenic
1142129459 16:88426078-88426100 GTGGTGTCTCATGCCCCTCCCGG - Intergenic
1142848893 17:2694915-2694937 CTGGGCTGTCATGACCCCCCAGG - Exonic
1144240303 17:13304149-13304171 CTGGACTGTCCTGCCCCTGCAGG - Intergenic
1144621759 17:16822730-16822752 TTGGGCTTTCTTGTCCCGCCAGG + Intergenic
1144884663 17:18449984-18450006 TTGGGCTTTCTTGTCCCGCCAGG - Intergenic
1145147564 17:20494393-20494415 TTGGGCTTTCTTGTCCCGCCAGG + Intergenic
1147573742 17:41587072-41587094 TTGGGCTTTCTTGTCCCGCCAGG + Intergenic
1148989506 17:51653216-51653238 GTGAGATGTCTCTCCCCTCCAGG - Intronic
1149950181 17:60977061-60977083 GGGGGCTGCCCTGCACCTCCCGG + Intronic
1151189673 17:72389055-72389077 GTAGCCTGTTTTCCCCCTCCAGG + Intergenic
1152813038 17:82391187-82391209 GTGGGCGGCCGTCCCCCTCCCGG + Intronic
1153814772 18:8782985-8783007 GTGGCCTGACTTCCCCATCCTGG + Intronic
1153975958 18:10268539-10268561 GGGGGCTTTATTGCCCTTCCAGG - Intergenic
1155458138 18:26044027-26044049 GTGGGCAGTTTTGTCCCTCAGGG + Intronic
1156111986 18:33739286-33739308 GTGGACTGTGTTTCCCCTCCTGG - Exonic
1157433681 18:47651324-47651346 CTGGGCTGTCTCGTCCCTCTGGG - Intergenic
1163008877 19:14412596-14412618 GACCGCTGTCTTGCCCATCCCGG + Exonic
1163182482 19:15614453-15614475 ATGGGCAGTACTGCCCCTCCTGG - Intergenic
1164521608 19:28984040-28984062 ATGGGCAGTCTTTCCCCTGCAGG - Intergenic
1165994986 19:39837668-39837690 GTGGCCTGTCCTACCCCACCGGG + Intronic
1167773431 19:51538187-51538209 GGGGGGTGTCGAGCCCCTCCAGG - Intergenic
925461985 2:4071416-4071438 GTGGCCTGTCTGGCCGTTCCTGG + Intergenic
926821434 2:16855328-16855350 CTGGGCTGCCGTGCCCTTCCAGG - Intergenic
926909435 2:17836986-17837008 GGGGTCTGTGTTGCTCCTCCAGG + Intergenic
928902640 2:36337009-36337031 TTGGGCTGGCTTGTCCCACCTGG + Intergenic
935732393 2:106074751-106074773 GTGGCCTGTGCTGCCCCACCAGG + Intronic
938724251 2:134092683-134092705 CTGGGCTCTCTTGCACCTCCAGG - Intergenic
939877951 2:147599058-147599080 TTGTGCTCTCTTGTCCCTCCAGG - Intergenic
939965548 2:148606879-148606901 GATGGCTGTATTGCCCCTCTGGG + Intergenic
941593930 2:167452340-167452362 GTGGGCTGTCTTGGTCCCCAAGG - Intergenic
943827471 2:192414242-192414264 GTGGCCTGGCTTGCGCCTGCAGG + Intergenic
945198049 2:207255822-207255844 GTGGGCTGTCCTGCTGCTCCCGG + Intergenic
945515144 2:210754220-210754242 GTAGGCTGTCTTTCCTCTACTGG + Intergenic
946023281 2:216656496-216656518 CTGGGCAGTTTTGCCTCTCCGGG + Intronic
948505449 2:238424596-238424618 GTGGGCTGTCTTGCCCCTCCAGG - Intergenic
948531062 2:238605995-238606017 GTGGGCTCTCTTGGCTTTCCTGG - Intergenic
948646421 2:239407865-239407887 GCAGGCTATCTGGCCCCTCCAGG - Intergenic
948648460 2:239424155-239424177 GTGAGCTCTCTTGCCCCACAAGG + Intergenic
948811861 2:240482440-240482462 GTGGACTGCCCTGCGCCTCCAGG - Intronic
948965053 2:241372748-241372770 CTGGGCTCTCTTGCCTCTGCTGG + Intronic
1171401470 20:24875289-24875311 CTGGGCTGGCTGGTCCCTCCTGG - Intergenic
1171847959 20:30289309-30289331 GAGGCCTGACTCGCCCCTCCAGG - Intergenic
1172642090 20:36446646-36446668 GCTGGCTATCTTGCCCATCCTGG - Intronic
1172880207 20:38194949-38194971 CTGCACTGTCTTGCCCCACCAGG - Intergenic
1173998655 20:47358561-47358583 GTGGGCTTTCTTGTCCCACACGG + Intergenic
1175943947 20:62550222-62550244 GGCTGCTGTCCTGCCCCTCCCGG - Intergenic
1176252335 20:64131721-64131743 ATGGGCTGCCCAGCCCCTCCTGG - Intergenic
1178396693 21:32249366-32249388 CTGTGCTGTCTTTCCCCGCCCGG - Intergenic
1179231283 21:39506126-39506148 GGGAACTGTCTGGCCCCTCCAGG - Intronic
1180883727 22:19224885-19224907 GGGGGCTGTCTGGCCCACCCAGG - Intronic
1181710041 22:24678845-24678867 GTGGGCAGTCAGGCCACTCCAGG - Intergenic
1182697069 22:32205021-32205043 GAGGGGTGGCTTGCCCTTCCAGG + Intergenic
1184010967 22:41748074-41748096 GTGGGCTGTGTTCTCTCTCCTGG + Intronic
1185061930 22:48611662-48611684 CTGGCCTTTCTTGCCTCTCCTGG + Intronic
1185190989 22:49435929-49435951 GTTGGCTGCCATGCCCCTGCTGG + Intronic
953701709 3:45201183-45201205 GTGGGCTGTATTGCCCTACTTGG - Intergenic
956251504 3:67239051-67239073 ATGGGTTCTCTTGCCCCTCCAGG + Intergenic
956435160 3:69228044-69228066 GTGGGCAATTTTGCCCCTCAGGG + Intronic
958538211 3:95432135-95432157 GTGGGCAGTTTTGCACTTCCTGG + Intergenic
961165834 3:124763298-124763320 CTGGGCTGTCTCTCCCTTCCAGG - Exonic
961441840 3:126958028-126958050 GTGTGCTGGCTTGGCCTTCCTGG + Intronic
961486723 3:127222083-127222105 GGGTGGTGTCTTGACCCTCCTGG - Intergenic
968525256 4:1053713-1053735 GGGAGCTGACTTTCCCCTCCGGG - Intergenic
968525281 4:1053813-1053835 GGGAGCTGACTTTCCCCTCCGGG - Intergenic
968525287 4:1053833-1053855 GGGAGCTGACTTTCCCCTCCGGG - Intergenic
968525418 4:1054400-1054422 GGGAGCTGACTTTCCCCTCCGGG - Intergenic
968525495 4:1054732-1054754 GGGAGCTGACTTTCCCCTCCGGG - Intergenic
968525528 4:1054878-1054900 GGGAGCTGACTTTCCCCTCCGGG - Intergenic
968525617 4:1055253-1055275 GGGAGCTGACTTTCCCCTCCGGG - Intergenic
968525628 4:1055293-1055315 GGGAGCTGACTTTCCCCTCCGGG - Intergenic
969568515 4:7994042-7994064 GTGGAGGGTCCTGCCCCTCCAGG - Intronic
969583872 4:8080900-8080922 CTGGTCTGTCCCGCCCCTCCCGG - Intronic
972072327 4:35038063-35038085 ATGGGCTGTCTGCCTCCTCCTGG - Intergenic
973316101 4:48762015-48762037 GTTAGCTCTCTTGCCTCTCCTGG - Intronic
999173678 5:149616699-149616721 GAGGGCTGTCTCTGCCCTCCAGG + Exonic
999196758 5:149786638-149786660 GTGGGCTGTCTAACCCCCACTGG + Intronic
999285521 5:150392147-150392169 GTGGGCTGACTTGGCCCCCTGGG - Exonic
1001109431 5:168883569-168883591 GTGGGTGGTCTCGCACCTCCAGG + Intronic
1001244918 5:170098821-170098843 GTGGGCTGTGGTGCCCCTCTGGG - Intergenic
1002494531 5:179602772-179602794 GAGTGCTGTTTTGCCCCTGCAGG - Intronic
1003126060 6:3356694-3356716 ATGGGCTGGCTTGAACCTCCAGG + Intronic
1003831297 6:10014941-10014963 GTGGGCTCTCGTGCCCCTTCTGG - Intronic
1004500034 6:16201077-16201099 GTTGGATGTCTTGCCTATCCAGG + Intergenic
1005990284 6:30897998-30898020 GTGGGCTCTCTCTCCTCTCCTGG + Intronic
1006078453 6:31549768-31549790 TTGGGCTGCCTAGGCCCTCCTGG + Intronic
1008793992 6:55277440-55277462 GTTGGCTGTCCTGGCCCTCGAGG - Exonic
1012183010 6:96178166-96178188 GTGGCTTGTCTTGGCCATCCTGG - Intronic
1013362919 6:109411126-109411148 CTGGCCACTCTTGCCCCTCCAGG + Intronic
1014809589 6:125870632-125870654 TCTGGCTGTCATGCCCCTCCAGG + Intronic
1019024112 6:168942876-168942898 CTGGGGTGTCTTGGCCTTCCCGG - Intergenic
1019411356 7:908162-908184 GGGGGCTGTTTAGCCCCGCCTGG - Intronic
1019741428 7:2676663-2676685 GTGGGCTGGTGTGCCCCACCAGG + Intergenic
1029225875 7:99028142-99028164 GTGATCTGTGTTGCCCCTCTCGG - Exonic
1031333954 7:120502582-120502604 GTGCAGTGTCTTGCCCCTTCAGG + Intronic
1035929670 8:3766234-3766256 GAGAGCTGTCATGCCCCACCTGG + Intronic
1038155003 8:24980851-24980873 CTTGGCTGTTTTGCACCTCCCGG - Intergenic
1040595531 8:48834445-48834467 GGGGGCTGCCCTGTCCCTCCTGG - Intergenic
1042871991 8:73407933-73407955 GTGGGCTGTCTGGCCACCCCAGG - Intergenic
1046315882 8:112501038-112501060 GTGGGCTGGCTTTCCCCTTTTGG + Intronic
1046960098 8:120102438-120102460 GTTTGCTCTCTTGCCCCTCGAGG + Intronic
1049149755 8:141027041-141027063 CTGGGCTGTCTTGCCCCCTGTGG - Intergenic
1049330098 8:142045865-142045887 CTGGGCTGTCCTGCCACTTCGGG - Intergenic
1049756018 8:144311646-144311668 GTGGGGTGGGTTGCCCCTGCCGG + Intronic
1050331731 9:4552641-4552663 CTGGACTCTCTTGCCCCTCTAGG - Intronic
1053786094 9:41653959-41653981 GAGGCCTGACTCGCCCCTCCAGG - Intergenic
1054174811 9:61867900-61867922 GAGGCCTGACTCGCCCCTCCAGG - Intergenic
1054662729 9:67712893-67712915 GAGGCCTGACTCGCCCCTCCAGG + Intergenic
1056580758 9:87886916-87886938 GTGGGCTTTCCCACCCCTCCAGG - Exonic
1061178068 9:129009224-129009246 GTGGCCAGCCTGGCCCCTCCGGG - Exonic
1061489915 9:130939149-130939171 GGGGGCTCTCAGGCCCCTCCGGG - Intronic
1061765457 9:132878550-132878572 GAGGGCCGACTTGCCCCTTCTGG - Exonic
1061870740 9:133519056-133519078 GTGGTCTCTCTTGCTCCTCCTGG + Intronic
1062100906 9:134728150-134728172 GAGCTCTGTCCTGCCCCTCCTGG - Intronic
1062207657 9:135346251-135346273 GTGGGCTGCCTTGCTCCTTGTGG + Exonic
1062277512 9:135737769-135737791 GTGGGCTGTTGGGCCCCTCCCGG + Intronic
1062406204 9:136397789-136397811 GTGAGCTGTGTTGACCATCCAGG + Intronic
1187672902 X:21686206-21686228 TTGGGCTTTCTGGCCCATCCTGG + Intergenic
1191864301 X:65691393-65691415 GTTGGCTGTCTGGCACCTCTTGG + Intronic
1194827317 X:98578875-98578897 GTGGGCTGTCTGGCTCCTCCAGG - Intergenic
1198223204 X:134621923-134621945 GTGGGCTGGCTTCCATCTCCAGG - Intronic
1200834769 Y:7722641-7722663 TTGGGCTGACCTGCCACTCCAGG - Intergenic
1201014860 Y:9590458-9590480 GTGAGGTGTCATGCCCCTGCTGG - Intergenic