ID: 948506929 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:238434811-238434833 |
| Sequence | TGAGCCTGAGTAAAAGAAGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 347 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 22, 4: 322} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 948506929_948506935 | 25 | Left | 948506929 | 2:238434811-238434833 | CCTCCTTCTTTTACTCAGGCTCA | 0: 1 1: 0 2: 2 3: 22 4: 322 |
||
| Right | 948506935 | 2:238434859-238434881 | CCCATTGCTATTTGCTTCTTTGG | 0: 1 1: 0 2: 1 3: 13 4: 186 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 948506929 | Original CRISPR | TGAGCCTGAGTAAAAGAAGG AGG (reversed) | Intronic | ||