ID: 948506935

View in Genome Browser
Species Human (GRCh38)
Location 2:238434859-238434881
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948506929_948506935 25 Left 948506929 2:238434811-238434833 CCTCCTTCTTTTACTCAGGCTCA 0: 1
1: 0
2: 2
3: 22
4: 322
Right 948506935 2:238434859-238434881 CCCATTGCTATTTGCTTCTTTGG 0: 1
1: 0
2: 1
3: 13
4: 186
948506931_948506935 22 Left 948506931 2:238434814-238434836 CCTTCTTTTACTCAGGCTCAGGG 0: 1
1: 0
2: 0
3: 24
4: 185
Right 948506935 2:238434859-238434881 CCCATTGCTATTTGCTTCTTTGG 0: 1
1: 0
2: 1
3: 13
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type