ID: 948507612

View in Genome Browser
Species Human (GRCh38)
Location 2:238440470-238440492
Sequence CAACACAGGCAGTATGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948507612_948507616 -3 Left 948507612 2:238440470-238440492 CCCTCCACATACTGCCTGTGTTG 0: 1
1: 0
2: 2
3: 20
4: 178
Right 948507616 2:238440490-238440512 TTGTCCTGTTGTCCCCTGTGTGG 0: 1
1: 0
2: 0
3: 20
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948507612 Original CRISPR CAACACAGGCAGTATGTGGA GGG (reversed) Intronic
901265433 1:7906763-7906785 GAACACGGGCAGTAGGAGGAAGG + Intergenic
902206096 1:14869173-14869195 CAAGACAGGCAGGAAGGGGATGG - Intronic
904269894 1:29343072-29343094 CAGTACAAACAGTATGTGGATGG - Intergenic
905110424 1:35590523-35590545 CTACACAGGCAGGATGGGGCAGG + Intronic
909021609 1:70437539-70437561 CCACATAGGCAGTATGTGGAAGG + Intronic
909918544 1:81351642-81351664 CAAACCAGCAAGTATGTGGAAGG + Intronic
912580458 1:110716616-110716638 TCACACAGTCAGTATGTGGTAGG + Intergenic
912652363 1:111450477-111450499 TCACACAGCCAGTAAGTGGAGGG - Intronic
912878676 1:113388603-113388625 CAGCACAGACACCATGTGGATGG - Intergenic
912882872 1:113435679-113435701 CAACACAGCTGATATGTGGAGGG + Intronic
912987344 1:114447256-114447278 CAACAGAGGTAGTACGTGGTAGG + Intronic
913224506 1:116687168-116687190 CTCCACAGGCAGAATGGGGAGGG - Intergenic
913270847 1:117091883-117091905 CAACTGGGACAGTATGTGGACGG - Exonic
915626708 1:157118378-157118400 CCTCACAGGCAGTAAGTGGCAGG + Intergenic
916197019 1:162234090-162234112 AAACACAGGCAGAATGTGATTGG + Intronic
916314099 1:163428291-163428313 AAATAAAGGCAGTCTGTGGATGG + Intergenic
918372429 1:183874532-183874554 CAACGCAGGGACTATGGGGAAGG - Intronic
918981495 1:191565996-191566018 TAATACAGGCAGTTAGTGGAAGG - Intergenic
920138680 1:203791400-203791422 TAACACTGGCATTATGTGGGAGG - Intergenic
920885731 1:209926077-209926099 CAACAAAAGCATTAGGTGGATGG - Intergenic
921284252 1:213594846-213594868 CAGCACAGGAAGTGAGTGGAGGG + Intergenic
1063927744 10:10997125-10997147 TGACACATGCAGTACGTGGAAGG - Intergenic
1065738288 10:28773473-28773495 CAAGACAGGGAGCATGTGTAGGG - Intergenic
1070730942 10:78827964-78827986 CATCACAGGCTGGAGGTGGAGGG - Intergenic
1075056438 10:119222374-119222396 CAGCACAGGCAGCACTTGGAGGG - Intronic
1075404863 10:122188009-122188031 AAAGGCAGGCAGGATGTGGAAGG - Intronic
1075759134 10:124841897-124841919 AAACACAGGCTGTATGTTTAAGG + Intergenic
1076386188 10:130057652-130057674 CAACAGGGTCAGCATGTGGATGG + Intergenic
1076479623 10:130776383-130776405 CAACAAAGGCAGAAAGTGAAGGG - Intergenic
1079673999 11:23202511-23202533 CACCACAGACAGTATGTTGATGG + Intergenic
1081447054 11:43140727-43140749 CCACACAGCAAGTATGTGGTAGG - Intergenic
1081562071 11:44226866-44226888 AAACTCAGGCAGTGTGTGCAAGG + Intronic
1081625376 11:44652193-44652215 CCAAACAGGCAGACTGTGGAAGG + Intergenic
1082830941 11:57616714-57616736 CAACAAAGTCAGGAGGTGGAAGG + Intergenic
1082890673 11:58135369-58135391 GAACACAGACAGCATGTGGGTGG + Intronic
1083191290 11:61054136-61054158 CCTCAAAGACAGTATGTGGATGG + Intergenic
1085126398 11:74005421-74005443 CACCACAGGCAGGATGTGGTAGG - Intronic
1085180305 11:74529409-74529431 CAAAACAAGCAGTGTGTAGAGGG - Intronic
1085594087 11:77792130-77792152 CAACTCACACACTATGTGGATGG + Intronic
1085796015 11:79540699-79540721 CCACACAGGCAGCATGGGAATGG - Intergenic
1089074982 11:115730971-115730993 TAGCACAGGCATTATGTGAAAGG + Intergenic
1089093979 11:115902805-115902827 CGACACAGGTAGTCTTTGGAAGG + Intergenic
1089864306 11:121618300-121618322 CACCCCAGGAAGTATGTGGAGGG - Intronic
1090357865 11:126152063-126152085 AAATACAGCCAGTGTGTGGAGGG - Intergenic
1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG + Intronic
1095863455 12:46945644-46945666 CAGCACAGGCAATATGGTGAAGG + Intergenic
1095992040 12:48041832-48041854 CCACAAAGGAAGTATGTGTAAGG + Intergenic
1096523615 12:52198088-52198110 GAGCCCAGGCAGGATGTGGAAGG + Intergenic
1098171421 12:67750988-67751010 CCACAAAGGCAGCATTTGGAAGG + Intergenic
1100141660 12:91626117-91626139 CAATACCGGCAGAATGTGGCTGG + Intergenic
1100807615 12:98303818-98303840 TAGCAAAGGCACTATGTGGAGGG - Intergenic
1101828395 12:108238721-108238743 AAACACAGCCAGTATCTTGAAGG + Intronic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1107771794 13:43794627-43794649 CTGCAGAGGCAGTATGTAGATGG - Intergenic
1113070143 13:106412314-106412336 CACCACAGGCTGAGTGTGGAAGG - Intergenic
1113614798 13:111672365-111672387 AAACAAATGCAGTATGTGAAAGG - Intronic
1113620267 13:111757279-111757301 AAACAAATGCAGTATGTGAAAGG - Intergenic
1113885057 13:113654466-113654488 AAGCACAGGAAGTAAGTGGATGG + Intronic
1115470809 14:33766717-33766739 CAACTCAGGAAGTAAGTGGATGG - Intronic
1116231415 14:42222801-42222823 ACACACACGCAATATGTGGAGGG - Intergenic
1118013407 14:61633384-61633406 CAACACAGGCATTATTTATAAGG - Intronic
1121458147 14:94052359-94052381 CAGCAGAGGCAGTTTGTGCAGGG - Intronic
1124687916 15:31798190-31798212 CAACACAGGCATTTTGTGGGGGG + Intronic
1126773423 15:52079312-52079334 CAACAGTGGCTGTCTGTGGAAGG - Intergenic
1128634865 15:69296749-69296771 AATCACAGGCAGGATCTGGAAGG - Intergenic
1129750507 15:78059581-78059603 CACCTCAAGCAGAATGTGGATGG - Intronic
1129775442 15:78233511-78233533 CAAGACAGGAAGTTTGGGGATGG - Intronic
1133419138 16:5630728-5630750 ATACCCAGGCAGTATCTGGAGGG + Intergenic
1133489295 16:6251393-6251415 TCACACAGTCAGTGTGTGGAGGG + Intronic
1135197019 16:20403111-20403133 GCACACAGGGAGAATGTGGAGGG - Intronic
1136375007 16:29860268-29860290 GAACACAGGCAGCCTCTGGAAGG - Intronic
1137657361 16:50171604-50171626 CAACACAGGCTGGATCTGTATGG + Intronic
1138897010 16:61218846-61218868 CAACACTGGCAGAAGCTGGAGGG - Intergenic
1139924672 16:70479551-70479573 CAAGACAGGAAGTATTTAGAAGG - Intronic
1141252307 16:82369745-82369767 CAACACAGGCAGCCTTTCGAAGG - Intergenic
1143707493 17:8709062-8709084 CAACTCAGGGTGTATGTGGAAGG + Intergenic
1144654792 17:17028648-17028670 TTGCACAGGCAGTATGTGGTGGG - Intergenic
1145282000 17:21475026-21475048 CAACAGACGCTGTATGAGGAGGG - Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146537889 17:33668887-33668909 CTACACTGGCAGCATCTGGAAGG - Intronic
1147208752 17:38858383-38858405 AAACAAAGGCAGAACGTGGAAGG - Intergenic
1151503832 17:74513042-74513064 CAACACAGGCAGTCGGGGGAGGG - Intergenic
1151744536 17:76004871-76004893 AAACCCAGACAGGATGTGGAAGG - Intronic
1154314985 18:13297407-13297429 CAGCACAGGCACTTTCTGGAAGG + Intronic
1155079217 18:22391226-22391248 CATCACTGGGAGAATGTGGATGG - Intergenic
1156126905 18:33917025-33917047 CAACCCAGGCACTATGCAGAAGG + Intronic
1158005743 18:52670288-52670310 GAATACAGGAAGGATGTGGATGG + Intronic
1161115936 19:2496356-2496378 AAACAAAGGTAGAATGTGGAAGG - Intergenic
1162502208 19:11060336-11060358 TCACACAGCCAGTATGTGGCAGG + Intronic
1163127280 19:15251157-15251179 GAACACAGGCAGGAGGAGGATGG - Intronic
1163288771 19:16365127-16365149 GAACACAGGCATGATGGGGAAGG - Intronic
1163561765 19:18023513-18023535 CAAAACAGGCAGGATGGGCAGGG + Intergenic
1165095439 19:33407391-33407413 CAGCCCAGGCTGTTTGTGGAAGG + Intronic
1165387967 19:35522829-35522851 TTACACAGTCAGTAAGTGGAAGG - Intergenic
1165689766 19:37854505-37854527 CCACACAGCCAGAATGTGGCAGG + Intergenic
1167353575 19:48990698-48990720 ACACACAGGCAGCAAGTGGAGGG + Intronic
1167644613 19:50699082-50699104 CAAGGGAGGCAGTTTGTGGAGGG - Intronic
925063982 2:914954-914976 ACACACAGGCAGTAGATGGAAGG + Intergenic
925380069 2:3418671-3418693 CAACTCAGGCAGTAGGGGGTGGG + Intronic
927810985 2:26180039-26180061 CAACAGAGGAAAAATGTGGAGGG - Intronic
931274255 2:60730382-60730404 CAACACAGGCAGGCTGAGGTGGG + Intergenic
933287433 2:80399687-80399709 AAACACAGACATTATCTGGAAGG - Intronic
936050288 2:109217578-109217600 TAACACATGCAGGATGTGGTAGG - Intronic
936729190 2:115360420-115360442 TTTCACAGGCAGTGTGTGGAAGG + Intronic
936983375 2:118285028-118285050 AAACTCAGCCAGTTTGTGGAAGG - Intergenic
937989060 2:127652247-127652269 CAACTCAGGCAGTGTGTGTCTGG - Exonic
942087464 2:172456636-172456658 CAACATAGCCTGTGTGTGGAAGG + Intronic
943536789 2:189162091-189162113 CCTCTCAGGCAGTATGTGGGAGG + Intronic
945403842 2:209422461-209422483 AATCATAGACAGTATGTGGATGG - Intergenic
947718427 2:232353109-232353131 CAATAAAGGCAGTCTGTGCAGGG - Intergenic
948327514 2:237137859-237137881 CCACACAGGCAGAATGTTGAGGG - Intergenic
948507612 2:238440470-238440492 CAACACAGGCAGTATGTGGAGGG - Intronic
948564330 2:238874074-238874096 CATCCCAGGCAGGATGTTGATGG + Intronic
1169041414 20:2498548-2498570 CAACAAAGGGAGTAAGTGGTAGG + Intronic
1171303356 20:24083561-24083583 CAACACAAGCAGTATGTGAGTGG + Intergenic
1173015834 20:39224814-39224836 CCACACAGCTAGTAAGTGGAGGG - Intergenic
1173450992 20:43163660-43163682 AAAAACAGGCTGTATGTGGAAGG + Intronic
1174420025 20:50393496-50393518 CAGGACAGGCAGTGTATGGAGGG - Intergenic
1174819646 20:53715418-53715440 CTAGACAAGGAGTATGTGGAAGG + Intergenic
1178366069 21:31989792-31989814 GAACACAGCCAGCATCTGGAAGG - Intronic
1181747957 22:24968769-24968791 CAACACATGCATGGTGTGGAGGG - Intronic
1183016958 22:34996695-34996717 CAGCACAGGCACTATGTGGATGG + Intergenic
1183764854 22:39863492-39863514 CAGCACAAGCAGTATCTGTATGG + Intronic
950935525 3:16835183-16835205 CAACACAGGTATTTTATGGATGG + Intronic
953100487 3:39820931-39820953 CAACCCAAGCAGAAAGTGGATGG - Intronic
953855585 3:46497232-46497254 AGACACATGCAGTTTGTGGACGG + Intergenic
954352929 3:50060405-50060427 CAAAACAGCCATTAAGTGGAGGG - Intronic
955012304 3:55030209-55030231 CAATACAGGGAGGATGTGGCTGG - Intronic
958491437 3:94779261-94779283 CAACAGTGGCAGTGTGTAGAAGG - Intergenic
960906441 3:122606459-122606481 AAACACAGGAAGAATGAGGAGGG + Intronic
962445444 3:135459652-135459674 GAAGACAGCCAGTCTGTGGAAGG + Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964055092 3:152445377-152445399 CAACACAGTCACTGTGTGTATGG + Exonic
965867398 3:173221473-173221495 AAACACTGGCAGTATCTAGAGGG - Intergenic
966364943 3:179175076-179175098 CAACACAGGAAGCAGGTGTAGGG - Intronic
967200782 3:187070744-187070766 CAACAGAGGTAGTATGAGGATGG - Intronic
968298552 3:197595723-197595745 CATCACAGGGAGGAAGTGGAAGG - Intergenic
968732063 4:2273870-2273892 CCACACAGGCAGGAGGAGGAGGG - Intronic
970644164 4:18100414-18100436 TAACACAGCCATTGTGTGGAGGG - Intergenic
971150870 4:24030165-24030187 AAACACAGCCAGTATGTGATTGG + Intergenic
971316700 4:25573642-25573664 AAAAACAGGCAGTAGTTGGAAGG - Intergenic
973804487 4:54512625-54512647 AAATACAGGCAGACTGTGGAAGG - Intergenic
973979572 4:56296706-56296728 CAACACAGGCAGCACTTGGAGGG - Intronic
977120361 4:93092148-93092170 CAACACTGGAAGTCTGTTGATGG + Intronic
977808570 4:101332896-101332918 CATCACTGGAAGTATGTGGAGGG + Intronic
982317375 4:154045456-154045478 CAACACAGCCAGTCAGTGGTGGG - Intergenic
984921482 4:184768067-184768089 CAACACAAGCATAATGTGGGAGG - Intronic
985964475 5:3329578-3329600 CAACAGAGGAAGTAGGTGGCAGG - Intergenic
986317348 5:6599048-6599070 CACCAAAGGCAGTGTGTGGTCGG + Intergenic
986371152 5:7081489-7081511 CAAGACAGGGAGTGGGTGGAAGG + Intergenic
991069166 5:62457506-62457528 CAACACATGAATTATTTGGATGG + Intronic
992868870 5:80985746-80985768 CAGCACAGGAAGGATGTGGAGGG + Intronic
994044085 5:95288543-95288565 CAACACAAGCAGAAAGTGAATGG + Intergenic
994705992 5:103207117-103207139 AAACACAGCCAGTCTCTGGAGGG - Intronic
997822809 5:137081136-137081158 AAACACAGACAGCATGAGGAGGG - Intronic
998801280 5:145872163-145872185 CAAAGCAGGCAGTATGAGGAAGG + Intronic
999019762 5:148152251-148152273 CAAAAAAGGCATTATGTTGAAGG + Intergenic
999085612 5:148886173-148886195 AAGCCCAGGCAGCATGTGGACGG + Intergenic
999640468 5:153667300-153667322 CAGCACAGGCAGGATGATGAGGG + Intronic
1000758949 5:165197162-165197184 CCACACAGGAAGAATGCGGAGGG - Intergenic
1001610594 5:172998264-172998286 GAACACAGGTTGCATGTGGAGGG + Intronic
1002139431 5:177130038-177130060 TTTCACAGGCAGTATGTGTAGGG + Intergenic
1002933796 6:1654331-1654353 CAAAACAGCCAGAATGTGGAGGG + Intronic
1009528897 6:64784774-64784796 CAACACAAGCAATAAGTGAAGGG - Intronic
1011125145 6:83999243-83999265 CTACACAGGCATTATATGCATGG + Intergenic
1011479519 6:87780132-87780154 CATTGCAGGTAGTATGTGGATGG + Intergenic
1012412841 6:98979299-98979321 CAGGACAGGCAGCATCTGGAAGG - Intergenic
1013950200 6:115771100-115771122 TAACACATGCTGTCTGTGGATGG - Intergenic
1014181587 6:118390297-118390319 CTACACAGCTAGTAGGTGGAGGG - Intergenic
1015134834 6:129856194-129856216 GAACACAGGCAGTATCTGGTAGG - Intronic
1015455875 6:133425534-133425556 CAAAACAGGAAGAAAGTGGAGGG - Intronic
1016373518 6:143397757-143397779 CAACACAGGAAGTCGGTGGTGGG - Intergenic
1019751681 7:2734755-2734777 CAACACAGGCAGTGCTGGGATGG - Intronic
1023155133 7:37242957-37242979 CAAAACAGGCAGAAGGTAGAGGG - Intronic
1023896865 7:44441238-44441260 CACAACAGTCAGTATGTGGAGGG + Intronic
1025250940 7:57350986-57351008 TAACATAGGCAGTGTGTGGAGGG + Intergenic
1026793170 7:73348417-73348439 CTATACAGGGAGGATGTGGACGG - Intronic
1028851283 7:95541047-95541069 CACCACAGCTAGTATCTGGAAGG + Intergenic
1029026062 7:97418169-97418191 TAGCACAGGGAGTATGTGGCTGG - Intergenic
1032242760 7:130177626-130177648 CAATACAGGAAGAAAGTGGACGG + Intronic
1032899018 7:136285310-136285332 CAACGCAGGCAGATTTTGGAGGG + Intergenic
1034120339 7:148621035-148621057 CAAGAGAGGCAGTAGGTCGAAGG - Intergenic
1034785264 7:153920512-153920534 CTACACAGGAAGTAAGTGAAGGG - Intronic
1035929417 8:3764251-3764273 GAACACAGGCAGTGTGTAGCTGG - Intronic
1037095837 8:14985723-14985745 CAACACAGGCTATATCTGCAAGG + Intronic
1037460990 8:19109449-19109471 AGACACAGGAAATATGTGGAAGG - Intergenic
1037954350 8:23042547-23042569 CAAGACAGGAAGCAGGTGGAGGG - Intronic
1038402980 8:27299542-27299564 GCACACAGCTAGTATGTGGAAGG + Intronic
1038624279 8:29175687-29175709 CAACAAAAGGAGTCTGTGGAAGG + Intronic
1038735611 8:30166534-30166556 ATACACAGGCATTATGTGGTGGG + Intronic
1041077755 8:54184717-54184739 CAACACAGGAAGCTTGTGAATGG - Intergenic
1044604030 8:94033489-94033511 CAGCACAGCCAGTAAGTGGTGGG + Intergenic
1044680374 8:94771768-94771790 AAACACAGGGAGCATGTGGCAGG + Intronic
1045508350 8:102794507-102794529 CGAGGCAGGCAGTATCTGGATGG - Intergenic
1051922923 9:22288696-22288718 AAACACAGGCAATCTGTGGTGGG - Intergenic
1059642285 9:116228964-116228986 CAACACAGGCACTATATGCTGGG + Intronic
1061408577 9:130406028-130406050 GAACACAGGCAGTACCAGGATGG - Intronic
1186832149 X:13401765-13401787 GAACACAGGTAAAATGTGGAAGG + Intergenic
1195661094 X:107379171-107379193 CAACTAAGGCAGTGTGTAGAGGG - Intergenic
1200267933 X:154655790-154655812 AAACACAGGCTGTGTGTGGCAGG + Intergenic
1201626289 Y:16018273-16018295 CAACACAGGAATTAAGTGGGAGG + Intergenic