ID: 948510119

View in Genome Browser
Species Human (GRCh38)
Location 2:238458413-238458435
Sequence CCTGAAGTGCAGAAGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948510110_948510119 3 Left 948510110 2:238458387-238458409 CCCTGGGACTGCCAGGAGCCAGG No data
Right 948510119 2:238458413-238458435 CCTGAAGTGCAGAAGCTGGTGGG No data
948510112_948510119 2 Left 948510112 2:238458388-238458410 CCTGGGACTGCCAGGAGCCAGGT No data
Right 948510119 2:238458413-238458435 CCTGAAGTGCAGAAGCTGGTGGG No data
948510113_948510119 -8 Left 948510113 2:238458398-238458420 CCAGGAGCCAGGTGCCCTGAAGT No data
Right 948510119 2:238458413-238458435 CCTGAAGTGCAGAAGCTGGTGGG No data
948510106_948510119 21 Left 948510106 2:238458369-238458391 CCGTGTGGGGAAGCTTTTCCCTG No data
Right 948510119 2:238458413-238458435 CCTGAAGTGCAGAAGCTGGTGGG No data
948510105_948510119 27 Left 948510105 2:238458363-238458385 CCAGTTCCGTGTGGGGAAGCTTT No data
Right 948510119 2:238458413-238458435 CCTGAAGTGCAGAAGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948510119 Original CRISPR CCTGAAGTGCAGAAGCTGGT GGG Intergenic
No off target data available for this crispr