ID: 948510944

View in Genome Browser
Species Human (GRCh38)
Location 2:238464829-238464851
Sequence GTGATGTCATTTATCAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948510944_948510949 29 Left 948510944 2:238464829-238464851 CCAGTGTTGATAAATGACATCAC No data
Right 948510949 2:238464881-238464903 ATCGCTGGTGTGACGCACCCTGG No data
948510944_948510946 14 Left 948510944 2:238464829-238464851 CCAGTGTTGATAAATGACATCAC No data
Right 948510946 2:238464866-238464888 ACAGTTGACACCGCCATCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948510944 Original CRISPR GTGATGTCATTTATCAACAC TGG (reversed) Intergenic
No off target data available for this crispr