ID: 948510944 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:238464829-238464851 |
| Sequence | GTGATGTCATTTATCAACAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 948510944_948510949 | 29 | Left | 948510944 | 2:238464829-238464851 | CCAGTGTTGATAAATGACATCAC | No data | ||
| Right | 948510949 | 2:238464881-238464903 | ATCGCTGGTGTGACGCACCCTGG | No data | ||||
| 948510944_948510946 | 14 | Left | 948510944 | 2:238464829-238464851 | CCAGTGTTGATAAATGACATCAC | No data | ||
| Right | 948510946 | 2:238464866-238464888 | ACAGTTGACACCGCCATCGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 948510944 | Original CRISPR | GTGATGTCATTTATCAACAC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||