ID: 948512265

View in Genome Browser
Species Human (GRCh38)
Location 2:238476488-238476510
Sequence CAGTGAGGCTGGAGTGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948512257_948512265 5 Left 948512257 2:238476460-238476482 CCACTCAAGGGGCTGAGAGGAGG No data
Right 948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG No data
948512253_948512265 11 Left 948512253 2:238476454-238476476 CCCAGCCCACTCAAGGGGCTGAG No data
Right 948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG No data
948512248_948512265 29 Left 948512248 2:238476436-238476458 CCCTGTGGTGGAAGGTCACCCAG No data
Right 948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG No data
948512256_948512265 6 Left 948512256 2:238476459-238476481 CCCACTCAAGGGGCTGAGAGGAG No data
Right 948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG No data
948512249_948512265 28 Left 948512249 2:238476437-238476459 CCTGTGGTGGAAGGTCACCCAGC No data
Right 948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG No data
948512254_948512265 10 Left 948512254 2:238476455-238476477 CCAGCCCACTCAAGGGGCTGAGA No data
Right 948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948512265 Original CRISPR CAGTGAGGCTGGAGTGCAGA GGG Intergenic
No off target data available for this crispr