ID: 948513726

View in Genome Browser
Species Human (GRCh38)
Location 2:238489693-238489715
Sequence CCCCGCCATGCCCAATGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948513726_948513729 1 Left 948513726 2:238489693-238489715 CCTGTGCATTGGGCATGGCGGGG No data
Right 948513729 2:238489717-238489739 CTCGTCATTGCCTTGAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948513726 Original CRISPR CCCCGCCATGCCCAATGCAC AGG (reversed) Intergenic
No off target data available for this crispr