ID: 948519692

View in Genome Browser
Species Human (GRCh38)
Location 2:238528027-238528049
Sequence GGCAGGAAGTGCATGGCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948519682_948519692 30 Left 948519682 2:238527974-238527996 CCAAAATGGACTTGAGGGCTGGA No data
Right 948519692 2:238528027-238528049 GGCAGGAAGTGCATGGCATTAGG No data
948519685_948519692 5 Left 948519685 2:238527999-238528021 CCAGGTGTGGAATCAATGAAACT No data
Right 948519692 2:238528027-238528049 GGCAGGAAGTGCATGGCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948519692 Original CRISPR GGCAGGAAGTGCATGGCATT AGG Intergenic
No off target data available for this crispr