ID: 948527121

View in Genome Browser
Species Human (GRCh38)
Location 2:238577960-238577982
Sequence TCGCACCTTCCCCTTGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948527121_948527128 25 Left 948527121 2:238577960-238577982 CCATCACCAAGGGGAAGGTGCGA No data
Right 948527128 2:238578008-238578030 ATGACCCAGACACCTCCCACCGG No data
948527121_948527123 -9 Left 948527121 2:238577960-238577982 CCATCACCAAGGGGAAGGTGCGA No data
Right 948527123 2:238577974-238577996 AAGGTGCGAAGCCATTCATGAGG No data
948527121_948527124 -8 Left 948527121 2:238577960-238577982 CCATCACCAAGGGGAAGGTGCGA No data
Right 948527124 2:238577975-238577997 AGGTGCGAAGCCATTCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948527121 Original CRISPR TCGCACCTTCCCCTTGGTGA TGG (reversed) Intergenic