ID: 948528279

View in Genome Browser
Species Human (GRCh38)
Location 2:238586970-238586992
Sequence CAGTGAGCAGAGTCCTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948528274_948528279 16 Left 948528274 2:238586931-238586953 CCTGGGAGAGAGAGCAGGGAGGA No data
Right 948528279 2:238586970-238586992 CAGTGAGCAGAGTCCTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948528279 Original CRISPR CAGTGAGCAGAGTCCTGGTG TGG Intergenic
No off target data available for this crispr