ID: 948531062

View in Genome Browser
Species Human (GRCh38)
Location 2:238605995-238606017
Sequence GTGGGCTCTCTTGGCTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948531062_948531072 17 Left 948531062 2:238605995-238606017 CCAGGAAAGCCAAGAGAGCCCAC No data
Right 948531072 2:238606035-238606057 CGGATTGCTCCTGCGGGATCTGG No data
948531062_948531071 11 Left 948531062 2:238605995-238606017 CCAGGAAAGCCAAGAGAGCCCAC No data
Right 948531071 2:238606029-238606051 AGGAATCGGATTGCTCCTGCGGG No data
948531062_948531070 10 Left 948531062 2:238605995-238606017 CCAGGAAAGCCAAGAGAGCCCAC No data
Right 948531070 2:238606028-238606050 AAGGAATCGGATTGCTCCTGCGG No data
948531062_948531073 18 Left 948531062 2:238605995-238606017 CCAGGAAAGCCAAGAGAGCCCAC No data
Right 948531073 2:238606036-238606058 GGATTGCTCCTGCGGGATCTGGG No data
948531062_948531064 -9 Left 948531062 2:238605995-238606017 CCAGGAAAGCCAAGAGAGCCCAC No data
Right 948531064 2:238606009-238606031 AGAGCCCACAGACCCTCTGAAGG No data
948531062_948531067 -3 Left 948531062 2:238605995-238606017 CCAGGAAAGCCAAGAGAGCCCAC No data
Right 948531067 2:238606015-238606037 CACAGACCCTCTGAAGGAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948531062 Original CRISPR GTGGGCTCTCTTGGCTTTCC TGG (reversed) Intergenic
No off target data available for this crispr