ID: 948534601

View in Genome Browser
Species Human (GRCh38)
Location 2:238636548-238636570
Sequence GGCTGCCTCCACTGGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948534601_948534606 -10 Left 948534601 2:238636548-238636570 CCTGCTCCCCAGTGGAGGCAGCC No data
Right 948534606 2:238636561-238636583 GGAGGCAGCCAGTGGTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948534601 Original CRISPR GGCTGCCTCCACTGGGGAGC AGG (reversed) Intergenic
No off target data available for this crispr