ID: 948535557

View in Genome Browser
Species Human (GRCh38)
Location 2:238643910-238643932
Sequence AGAAGGGAGTCTCCCTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948535557_948535565 -1 Left 948535557 2:238643910-238643932 CCCCTGGAGGGAGACTCCCTTCT No data
Right 948535565 2:238643932-238643954 TCTGTGGGGTTTGCTCTGAGTGG No data
948535557_948535566 12 Left 948535557 2:238643910-238643932 CCCCTGGAGGGAGACTCCCTTCT No data
Right 948535566 2:238643945-238643967 CTCTGAGTGGTTAATAATCCAGG No data
948535557_948535567 27 Left 948535557 2:238643910-238643932 CCCCTGGAGGGAGACTCCCTTCT No data
Right 948535567 2:238643960-238643982 AATCCAGGTAGAAAATCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948535557 Original CRISPR AGAAGGGAGTCTCCCTCCAG GGG (reversed) Intergenic
No off target data available for this crispr