ID: 948535559

View in Genome Browser
Species Human (GRCh38)
Location 2:238643912-238643934
Sequence AGAGAAGGGAGTCTCCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948535559_948535567 25 Left 948535559 2:238643912-238643934 CCTGGAGGGAGACTCCCTTCTCT No data
Right 948535567 2:238643960-238643982 AATCCAGGTAGAAAATCCACTGG No data
948535559_948535566 10 Left 948535559 2:238643912-238643934 CCTGGAGGGAGACTCCCTTCTCT No data
Right 948535566 2:238643945-238643967 CTCTGAGTGGTTAATAATCCAGG No data
948535559_948535565 -3 Left 948535559 2:238643912-238643934 CCTGGAGGGAGACTCCCTTCTCT No data
Right 948535565 2:238643932-238643954 TCTGTGGGGTTTGCTCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948535559 Original CRISPR AGAGAAGGGAGTCTCCCTCC AGG (reversed) Intergenic
No off target data available for this crispr