ID: 948535563

View in Genome Browser
Species Human (GRCh38)
Location 2:238643926-238643948
Sequence AGAGCAAACCCCACAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948535563_948535566 -4 Left 948535563 2:238643926-238643948 CCCTTCTCTGTGGGGTTTGCTCT No data
Right 948535566 2:238643945-238643967 CTCTGAGTGGTTAATAATCCAGG No data
948535563_948535573 30 Left 948535563 2:238643926-238643948 CCCTTCTCTGTGGGGTTTGCTCT No data
Right 948535573 2:238643979-238644001 CTGGTAGAGGTAGTGCAGGGTGG No data
948535563_948535569 17 Left 948535563 2:238643926-238643948 CCCTTCTCTGTGGGGTTTGCTCT No data
Right 948535569 2:238643966-238643988 GGTAGAAAATCCACTGGTAGAGG No data
948535563_948535570 26 Left 948535563 2:238643926-238643948 CCCTTCTCTGTGGGGTTTGCTCT No data
Right 948535570 2:238643975-238643997 TCCACTGGTAGAGGTAGTGCAGG No data
948535563_948535567 11 Left 948535563 2:238643926-238643948 CCCTTCTCTGTGGGGTTTGCTCT No data
Right 948535567 2:238643960-238643982 AATCCAGGTAGAAAATCCACTGG No data
948535563_948535572 27 Left 948535563 2:238643926-238643948 CCCTTCTCTGTGGGGTTTGCTCT No data
Right 948535572 2:238643976-238643998 CCACTGGTAGAGGTAGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948535563 Original CRISPR AGAGCAAACCCCACAGAGAA GGG (reversed) Intergenic
No off target data available for this crispr