ID: 948535567

View in Genome Browser
Species Human (GRCh38)
Location 2:238643960-238643982
Sequence AATCCAGGTAGAAAATCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948535564_948535567 10 Left 948535564 2:238643927-238643949 CCTTCTCTGTGGGGTTTGCTCTG No data
Right 948535567 2:238643960-238643982 AATCCAGGTAGAAAATCCACTGG No data
948535557_948535567 27 Left 948535557 2:238643910-238643932 CCCCTGGAGGGAGACTCCCTTCT No data
Right 948535567 2:238643960-238643982 AATCCAGGTAGAAAATCCACTGG No data
948535559_948535567 25 Left 948535559 2:238643912-238643934 CCTGGAGGGAGACTCCCTTCTCT No data
Right 948535567 2:238643960-238643982 AATCCAGGTAGAAAATCCACTGG No data
948535558_948535567 26 Left 948535558 2:238643911-238643933 CCCTGGAGGGAGACTCCCTTCTC No data
Right 948535567 2:238643960-238643982 AATCCAGGTAGAAAATCCACTGG No data
948535563_948535567 11 Left 948535563 2:238643926-238643948 CCCTTCTCTGTGGGGTTTGCTCT No data
Right 948535567 2:238643960-238643982 AATCCAGGTAGAAAATCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948535567 Original CRISPR AATCCAGGTAGAAAATCCAC TGG Intergenic
No off target data available for this crispr