ID: 948535607

View in Genome Browser
Species Human (GRCh38)
Location 2:238644173-238644195
Sequence GGTGCCTTAGGCTCCACTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948535600_948535607 28 Left 948535600 2:238644122-238644144 CCCTCACTCACTGGATAAGAACA No data
Right 948535607 2:238644173-238644195 GGTGCCTTAGGCTCCACTGTTGG No data
948535605_948535607 -5 Left 948535605 2:238644155-238644177 CCTCACTGAGCTTTCACTGGTGC No data
Right 948535607 2:238644173-238644195 GGTGCCTTAGGCTCCACTGTTGG No data
948535601_948535607 27 Left 948535601 2:238644123-238644145 CCTCACTCACTGGATAAGAACAG No data
Right 948535607 2:238644173-238644195 GGTGCCTTAGGCTCCACTGTTGG No data
948535603_948535607 -2 Left 948535603 2:238644152-238644174 CCTCCTCACTGAGCTTTCACTGG No data
Right 948535607 2:238644173-238644195 GGTGCCTTAGGCTCCACTGTTGG No data
948535598_948535607 30 Left 948535598 2:238644120-238644142 CCCCCTCACTCACTGGATAAGAA No data
Right 948535607 2:238644173-238644195 GGTGCCTTAGGCTCCACTGTTGG No data
948535599_948535607 29 Left 948535599 2:238644121-238644143 CCCCTCACTCACTGGATAAGAAC No data
Right 948535607 2:238644173-238644195 GGTGCCTTAGGCTCCACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948535607 Original CRISPR GGTGCCTTAGGCTCCACTGT TGG Intergenic
No off target data available for this crispr