ID: 948535866

View in Genome Browser
Species Human (GRCh38)
Location 2:238646329-238646351
Sequence ATCCCATCACTTTTGGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948535866_948535871 -2 Left 948535866 2:238646329-238646351 CCATGGTCCAAAAGTGATGGGAT No data
Right 948535871 2:238646350-238646372 ATTTCTGGGTGACCTTTTCTGGG No data
948535866_948535878 30 Left 948535866 2:238646329-238646351 CCATGGTCCAAAAGTGATGGGAT No data
Right 948535878 2:238646382-238646404 CTTGGTGTTGGTGGGATTTCTGG No data
948535866_948535870 -3 Left 948535866 2:238646329-238646351 CCATGGTCCAAAAGTGATGGGAT No data
Right 948535870 2:238646349-238646371 GATTTCTGGGTGACCTTTTCTGG No data
948535866_948535876 22 Left 948535866 2:238646329-238646351 CCATGGTCCAAAAGTGATGGGAT No data
Right 948535876 2:238646374-238646396 ACAGTCTCCTTGGTGTTGGTGGG No data
948535866_948535875 21 Left 948535866 2:238646329-238646351 CCATGGTCCAAAAGTGATGGGAT No data
Right 948535875 2:238646373-238646395 TACAGTCTCCTTGGTGTTGGTGG No data
948535866_948535873 12 Left 948535866 2:238646329-238646351 CCATGGTCCAAAAGTGATGGGAT No data
Right 948535873 2:238646364-238646386 TTTTCTGGGTACAGTCTCCTTGG No data
948535866_948535874 18 Left 948535866 2:238646329-238646351 CCATGGTCCAAAAGTGATGGGAT No data
Right 948535874 2:238646370-238646392 GGGTACAGTCTCCTTGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948535866 Original CRISPR ATCCCATCACTTTTGGACCA TGG (reversed) Intergenic
No off target data available for this crispr