ID: 948543378

View in Genome Browser
Species Human (GRCh38)
Location 2:238705597-238705619
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265827
Summary {0: 8, 1: 1133, 2: 25627, 3: 79568, 4: 159491}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948543378_948543385 -8 Left 948543378 2:238705597-238705619 CCACCCACCTTGGCCTTCCACAG 0: 8
1: 1133
2: 25627
3: 79568
4: 159491
Right 948543385 2:238705612-238705634 TTCCACAGTGCTGGGATTACAGG 0: 88
1: 12765
2: 310723
3: 261915
4: 145751

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948543378 Original CRISPR CTGTGGAAGGCCAAGGTGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr