ID: 948543385

View in Genome Browser
Species Human (GRCh38)
Location 2:238705612-238705634
Sequence TTCCACAGTGCTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 731242
Summary {0: 88, 1: 12765, 2: 310723, 3: 261915, 4: 145751}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948543378_948543385 -8 Left 948543378 2:238705597-238705619 CCACCCACCTTGGCCTTCCACAG 0: 8
1: 1133
2: 25627
3: 79568
4: 159491
Right 948543385 2:238705612-238705634 TTCCACAGTGCTGGGATTACAGG 0: 88
1: 12765
2: 310723
3: 261915
4: 145751
948543375_948543385 6 Left 948543375 2:238705583-238705605 CCTATCCTCGTGATCCACCCACC No data
Right 948543385 2:238705612-238705634 TTCCACAGTGCTGGGATTACAGG 0: 88
1: 12765
2: 310723
3: 261915
4: 145751
948543377_948543385 1 Left 948543377 2:238705588-238705610 CCTCGTGATCCACCCACCTTGGC 0: 1551
1: 9910
2: 30351
3: 58849
4: 59461
Right 948543385 2:238705612-238705634 TTCCACAGTGCTGGGATTACAGG 0: 88
1: 12765
2: 310723
3: 261915
4: 145751

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948543385 Original CRISPR TTCCACAGTGCTGGGATTAC AGG Intergenic
Too many off-targets to display for this crispr