ID: 948543385 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:238705612-238705634 |
Sequence | TTCCACAGTGCTGGGATTAC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 731242 | |||
Summary | {0: 88, 1: 12765, 2: 310723, 3: 261915, 4: 145751} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
948543378_948543385 | -8 | Left | 948543378 | 2:238705597-238705619 | CCACCCACCTTGGCCTTCCACAG | 0: 8 1: 1133 2: 25627 3: 79568 4: 159491 |
||
Right | 948543385 | 2:238705612-238705634 | TTCCACAGTGCTGGGATTACAGG | 0: 88 1: 12765 2: 310723 3: 261915 4: 145751 |
||||
948543375_948543385 | 6 | Left | 948543375 | 2:238705583-238705605 | CCTATCCTCGTGATCCACCCACC | No data | ||
Right | 948543385 | 2:238705612-238705634 | TTCCACAGTGCTGGGATTACAGG | 0: 88 1: 12765 2: 310723 3: 261915 4: 145751 |
||||
948543377_948543385 | 1 | Left | 948543377 | 2:238705588-238705610 | CCTCGTGATCCACCCACCTTGGC | 0: 1551 1: 9910 2: 30351 3: 58849 4: 59461 |
||
Right | 948543385 | 2:238705612-238705634 | TTCCACAGTGCTGGGATTACAGG | 0: 88 1: 12765 2: 310723 3: 261915 4: 145751 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
948543385 | Original CRISPR | TTCCACAGTGCTGGGATTAC AGG | Intergenic | ||
Too many off-targets to display for this crispr |