ID: 948546169

View in Genome Browser
Species Human (GRCh38)
Location 2:238730352-238730374
Sequence GTCTGAGGTCCCTACTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948546169_948546172 -9 Left 948546169 2:238730352-238730374 CCTCCTCAGTAGGGACCTCAGAC No data
Right 948546172 2:238730366-238730388 ACCTCAGACAGAAGGAGCCGTGG No data
948546169_948546174 -5 Left 948546169 2:238730352-238730374 CCTCCTCAGTAGGGACCTCAGAC No data
Right 948546174 2:238730370-238730392 CAGACAGAAGGAGCCGTGGACGG No data
948546169_948546176 13 Left 948546169 2:238730352-238730374 CCTCCTCAGTAGGGACCTCAGAC No data
Right 948546176 2:238730388-238730410 GACGGCCGCTCTGTTAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948546169 Original CRISPR GTCTGAGGTCCCTACTGAGG AGG (reversed) Intergenic
No off target data available for this crispr