ID: 948550000

View in Genome Browser
Species Human (GRCh38)
Location 2:238764973-238764995
Sequence CCTTCTTAGCAGGAGTGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948549987_948550000 22 Left 948549987 2:238764928-238764950 CCTTTGCGTGCACCTGGCTACAG No data
Right 948550000 2:238764973-238764995 CCTTCTTAGCAGGAGTGAGAGGG No data
948549988_948550000 10 Left 948549988 2:238764940-238764962 CCTGGCTACAGAGCTCCCCCCCC No data
Right 948550000 2:238764973-238764995 CCTTCTTAGCAGGAGTGAGAGGG No data
948549994_948550000 -10 Left 948549994 2:238764960-238764982 CCCAGTCTCCACGCCTTCTTAGC No data
Right 948550000 2:238764973-238764995 CCTTCTTAGCAGGAGTGAGAGGG No data
948549992_948550000 -8 Left 948549992 2:238764958-238764980 CCCCCAGTCTCCACGCCTTCTTA No data
Right 948550000 2:238764973-238764995 CCTTCTTAGCAGGAGTGAGAGGG No data
948549990_948550000 -6 Left 948549990 2:238764956-238764978 CCCCCCCAGTCTCCACGCCTTCT No data
Right 948550000 2:238764973-238764995 CCTTCTTAGCAGGAGTGAGAGGG No data
948549989_948550000 -5 Left 948549989 2:238764955-238764977 CCCCCCCCAGTCTCCACGCCTTC No data
Right 948550000 2:238764973-238764995 CCTTCTTAGCAGGAGTGAGAGGG No data
948549993_948550000 -9 Left 948549993 2:238764959-238764981 CCCCAGTCTCCACGCCTTCTTAG No data
Right 948550000 2:238764973-238764995 CCTTCTTAGCAGGAGTGAGAGGG No data
948549991_948550000 -7 Left 948549991 2:238764957-238764979 CCCCCCAGTCTCCACGCCTTCTT No data
Right 948550000 2:238764973-238764995 CCTTCTTAGCAGGAGTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948550000 Original CRISPR CCTTCTTAGCAGGAGTGAGA GGG Intergenic
No off target data available for this crispr