ID: 948554281

View in Genome Browser
Species Human (GRCh38)
Location 2:238796517-238796539
Sequence GCTGATGTGGAGCAGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948554281_948554286 -6 Left 948554281 2:238796517-238796539 CCCACTCCCTGCTCCACATCAGC No data
Right 948554286 2:238796534-238796556 ATCAGCTTCTCACTAAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948554281 Original CRISPR GCTGATGTGGAGCAGGGAGT GGG (reversed) Intergenic
No off target data available for this crispr