ID: 948554326

View in Genome Browser
Species Human (GRCh38)
Location 2:238796793-238796815
Sequence ATGTGAGAATGTCAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948554326_948554330 11 Left 948554326 2:238796793-238796815 CCTTCTTCCTGACATTCTCACAT No data
Right 948554330 2:238796827-238796849 TCAGTGTAAATGAGACGGGAAGG No data
948554326_948554328 6 Left 948554326 2:238796793-238796815 CCTTCTTCCTGACATTCTCACAT No data
Right 948554328 2:238796822-238796844 CAAATTCAGTGTAAATGAGACGG No data
948554326_948554331 18 Left 948554326 2:238796793-238796815 CCTTCTTCCTGACATTCTCACAT No data
Right 948554331 2:238796834-238796856 AAATGAGACGGGAAGGTAACTGG No data
948554326_948554332 19 Left 948554326 2:238796793-238796815 CCTTCTTCCTGACATTCTCACAT No data
Right 948554332 2:238796835-238796857 AATGAGACGGGAAGGTAACTGGG No data
948554326_948554329 7 Left 948554326 2:238796793-238796815 CCTTCTTCCTGACATTCTCACAT No data
Right 948554329 2:238796823-238796845 AAATTCAGTGTAAATGAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948554326 Original CRISPR ATGTGAGAATGTCAGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr