ID: 948554540 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:238798636-238798658 |
Sequence | TTGGAAGCACAATAGGAGGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
948554535_948554540 | 5 | Left | 948554535 | 2:238798608-238798630 | CCCAAGTAGTTCACATTCTAGTG | No data | ||
Right | 948554540 | 2:238798636-238798658 | TTGGAAGCACAATAGGAGGAAGG | No data | ||||
948554536_948554540 | 4 | Left | 948554536 | 2:238798609-238798631 | CCAAGTAGTTCACATTCTAGTGA | No data | ||
Right | 948554540 | 2:238798636-238798658 | TTGGAAGCACAATAGGAGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
948554540 | Original CRISPR | TTGGAAGCACAATAGGAGGA AGG | Intergenic | ||
No off target data available for this crispr |