ID: 948554540

View in Genome Browser
Species Human (GRCh38)
Location 2:238798636-238798658
Sequence TTGGAAGCACAATAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948554535_948554540 5 Left 948554535 2:238798608-238798630 CCCAAGTAGTTCACATTCTAGTG No data
Right 948554540 2:238798636-238798658 TTGGAAGCACAATAGGAGGAAGG No data
948554536_948554540 4 Left 948554536 2:238798609-238798631 CCAAGTAGTTCACATTCTAGTGA No data
Right 948554540 2:238798636-238798658 TTGGAAGCACAATAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948554540 Original CRISPR TTGGAAGCACAATAGGAGGA AGG Intergenic
No off target data available for this crispr