ID: 948555387

View in Genome Browser
Species Human (GRCh38)
Location 2:238806557-238806579
Sequence GTGTTGAAACCTGTAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948555387_948555392 8 Left 948555387 2:238806557-238806579 CCAGTTTTTACAGGTTTCAACAC No data
Right 948555392 2:238806588-238806610 TTCTGGAGTTATCACTTTGGTGG No data
948555387_948555391 5 Left 948555387 2:238806557-238806579 CCAGTTTTTACAGGTTTCAACAC No data
Right 948555391 2:238806585-238806607 CCGTTCTGGAGTTATCACTTTGG No data
948555387_948555389 -9 Left 948555387 2:238806557-238806579 CCAGTTTTTACAGGTTTCAACAC No data
Right 948555389 2:238806571-238806593 TTTCAACACGATGGCCGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948555387 Original CRISPR GTGTTGAAACCTGTAAAAAC TGG (reversed) Intergenic
No off target data available for this crispr