ID: 948555712

View in Genome Browser
Species Human (GRCh38)
Location 2:238809494-238809516
Sequence AGTTTGTGATAGGGGCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948555712_948555716 2 Left 948555712 2:238809494-238809516 CCTTCTAGCCCCTATCACAAACT No data
Right 948555716 2:238809519-238809541 ACCTAATTCAGAAACACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948555712 Original CRISPR AGTTTGTGATAGGGGCTAGA AGG (reversed) Intergenic
No off target data available for this crispr