ID: 948559906

View in Genome Browser
Species Human (GRCh38)
Location 2:238845914-238845936
Sequence GGCCCCGGGGACGCCCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 232}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948559906_948559914 -5 Left 948559906 2:238845914-238845936 CCTTCCAGGGCGTCCCCGGGGCC 0: 1
1: 0
2: 1
3: 31
4: 232
Right 948559914 2:238845932-238845954 GGGCCTCTGGTCTTCAGGGCTGG 0: 1
1: 0
2: 3
3: 32
4: 309
948559906_948559912 -9 Left 948559906 2:238845914-238845936 CCTTCCAGGGCGTCCCCGGGGCC 0: 1
1: 0
2: 1
3: 31
4: 232
Right 948559912 2:238845928-238845950 CCCGGGGCCTCTGGTCTTCAGGG 0: 1
1: 1
2: 1
3: 20
4: 197
948559906_948559918 8 Left 948559906 2:238845914-238845936 CCTTCCAGGGCGTCCCCGGGGCC 0: 1
1: 0
2: 1
3: 31
4: 232
Right 948559918 2:238845945-238845967 TCAGGGCTGGGCTGAGCCCTGGG 0: 1
1: 0
2: 7
3: 56
4: 543
948559906_948559910 -10 Left 948559906 2:238845914-238845936 CCTTCCAGGGCGTCCCCGGGGCC 0: 1
1: 0
2: 1
3: 31
4: 232
Right 948559910 2:238845927-238845949 CCCCGGGGCCTCTGGTCTTCAGG 0: 1
1: 0
2: 0
3: 25
4: 210
948559906_948559919 17 Left 948559906 2:238845914-238845936 CCTTCCAGGGCGTCCCCGGGGCC 0: 1
1: 0
2: 1
3: 31
4: 232
Right 948559919 2:238845954-238845976 GGCTGAGCCCTGGGCTGCTCAGG 0: 1
1: 0
2: 2
3: 72
4: 588
948559906_948559915 -4 Left 948559906 2:238845914-238845936 CCTTCCAGGGCGTCCCCGGGGCC 0: 1
1: 0
2: 1
3: 31
4: 232
Right 948559915 2:238845933-238845955 GGCCTCTGGTCTTCAGGGCTGGG 0: 1
1: 0
2: 2
3: 38
4: 287
948559906_948559917 7 Left 948559906 2:238845914-238845936 CCTTCCAGGGCGTCCCCGGGGCC 0: 1
1: 0
2: 1
3: 31
4: 232
Right 948559917 2:238845944-238845966 TTCAGGGCTGGGCTGAGCCCTGG 0: 1
1: 3
2: 3
3: 60
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948559906 Original CRISPR GGCCCCGGGGACGCCCTGGA AGG (reversed) Intergenic
900137044 1:1122105-1122127 GGTCCCGGGGAAGCCATGGCGGG - Intergenic
900149481 1:1171860-1171882 GTCCCTGGGGAGTCCCTGGAAGG - Intergenic
900180510 1:1309022-1309044 GACCCCGGGGACGCGCGGGCGGG - Intronic
900356657 1:2268256-2268278 GCCCCCTGGGAGGCACTGGAGGG - Intronic
900374674 1:2348024-2348046 GGCCACGGGGAAGCCCAGGCTGG - Intronic
900489001 1:2937004-2937026 GGCCCTGTGGACGCGCTGGCGGG - Intergenic
900583181 1:3419262-3419284 GGTCCCGGGGACAGCCTGGATGG + Intronic
901222028 1:7588646-7588668 GGCCCTGGGGTTGCCCTGCAAGG - Intronic
902471545 1:16649961-16649983 GGCCCTGGGCCAGCCCTGGAAGG + Intergenic
902487264 1:16757484-16757506 GGCCCTGGGCCAGCCCTGGAAGG - Intronic
903069181 1:20718090-20718112 GGCCCCGGGAACGCCCCGCCTGG + Intergenic
903224171 1:21885496-21885518 GGCCCTGGGGATGCCCAGGGAGG - Intronic
904641961 1:31937954-31937976 GGCGCGGGGGCCGCCCGGGAGGG + Intronic
905553021 1:38859335-38859357 GGTAGCGGGGACGCCCGGGAGGG - Intronic
907243324 1:53092529-53092551 AGCCCCGGGGACGGGCAGGACGG - Intronic
907249652 1:53129693-53129715 GGCCCCTGGGCTGCCATGGAGGG - Intronic
909599643 1:77448267-77448289 GGCCCATGGGAAGCCATGGATGG - Intronic
913609515 1:120496455-120496477 GGCTCTGGGGAAGTCCTGGATGG - Intergenic
914204305 1:145514061-145514083 GGCTCTGGGGAAGTCCTGGATGG + Intergenic
914483428 1:148087249-148087271 GGCTCTGGGGAAGTCCTGGATGG + Intergenic
914581676 1:149025389-149025411 GGCTCTGGGGAAGTCCTGGATGG + Intronic
920172640 1:204081501-204081523 GGCCCCACGGACCCCCTGGCGGG + Intronic
921747193 1:218752242-218752264 GTCCCCAGAGACGCCCTGGAAGG - Intergenic
922473183 1:225888996-225889018 AGCCCCGGGGCCGCCCTGACCGG - Exonic
922732026 1:227953600-227953622 GGCCGTGGGGAGGCCCAGGACGG + Intergenic
1065883617 10:30058842-30058864 GGCCCCGGGCACTCGCTGGGAGG + Intronic
1068827175 10:61453129-61453151 GGCTCCGGGCACGCCCGGCAGGG - Exonic
1075320146 10:121485004-121485026 AGCCGCGGGGCCGCCCTGCAGGG - Intronic
1076417365 10:130301155-130301177 GGCCCCGGGGACCGCCTGCCGGG + Intergenic
1076417523 10:130301736-130301758 GGCCCCGGGGACCGCCTGCCGGG + Intergenic
1077266389 11:1652927-1652949 GGCTGCGCGGAAGCCCTGGAGGG + Intergenic
1077431335 11:2517339-2517361 AGCTCCTGGGACACCCTGGAGGG + Intronic
1077486971 11:2843434-2843456 GGCCCTGGGGAGGCCCTGCCTGG + Intronic
1077505657 11:2928925-2928947 GGCTGCGGGGATGGCCTGGAGGG + Exonic
1077535985 11:3124454-3124476 GGCTCAGGGGACTCCCAGGAGGG - Intronic
1077592168 11:3500587-3500609 GTCCCAGCGGAAGCCCTGGAAGG + Intergenic
1078164212 11:8868906-8868928 GGCCCATGGGCCGCCCAGGACGG + Intronic
1078540501 11:12209577-12209599 GGCCGCAGGAACACCCTGGAAGG + Exonic
1079569325 11:21922830-21922852 GGCCCCAGTCACTCCCTGGAAGG + Intergenic
1083669577 11:64292399-64292421 GGGCGCGGGGGCACCCTGGAGGG + Intronic
1084247996 11:67873327-67873349 GTCCCAGCGGAAGCCCTGGAAGG + Intergenic
1084589313 11:70080903-70080925 GGTGCCGGGGATGCCCTGGGAGG - Intronic
1084712437 11:70852370-70852392 GGCCCCGTGGAGCCCCTGCATGG - Intronic
1084824816 11:71722165-71722187 GTCCCAGCGGAAGCCCTGGAAGG - Intergenic
1089622150 11:119728421-119728443 AGCCCCGGGGAGGCATTGGATGG + Intronic
1090120702 11:124023796-124023818 GGCTCCAGGGACGTCGTGGATGG + Exonic
1090121807 11:124038196-124038218 GGCTCCAGGGACGCCTTGCATGG - Exonic
1090260361 11:125314804-125314826 AGCCCCGGGGCAGCCCTGGCTGG + Intronic
1090835261 11:130449233-130449255 GCCCCCGGTGAGCCCCTGGAGGG - Exonic
1091223271 11:133943439-133943461 GTCCTCGGGGTCTCCCTGGAGGG - Intronic
1092279943 12:7091302-7091324 GAGCCCGGGGATGCCCTGGATGG - Intronic
1092988023 12:13865822-13865844 GCCCCCGTGGATGCCCAGGATGG + Exonic
1096156145 12:49342489-49342511 GGCCCCGGGCACTCCCCGAAGGG + Intergenic
1097225755 12:57476041-57476063 GGCCTTGGGGACGCGCGGGAGGG + Intronic
1102591388 12:113959211-113959233 GGAGCCGGGGAGGACCTGGAAGG - Exonic
1104605653 12:130185629-130185651 GGTCCCGGGAACGCCCTGCAGGG + Intergenic
1104841504 12:131828180-131828202 GGCGGCGGGGACGCGCGGGATGG - Intergenic
1105207332 13:18235056-18235078 GTCCTCGGCGATGCCCTGGACGG - Intergenic
1105211916 13:18261955-18261977 GCCCACGGGGAAGCCCTGGCGGG + Intergenic
1105472092 13:20703790-20703812 GGCCCCGGGGACCCCGCGGGCGG + Intronic
1105781113 13:23705970-23705992 GGGCCCCGGGACTCCCTGGATGG + Intergenic
1107359118 13:39600977-39600999 TGCGCTGGGGATGCCCTGGAAGG + Exonic
1107873061 13:44764631-44764653 GGCCCCAGGGATGCGCTGGCAGG - Intergenic
1110247927 13:73348059-73348081 AGCCCAGGGGACTCCCTGGATGG + Intergenic
1114559089 14:23578101-23578123 GGCCCAGGGGAGGCTCTGCAGGG + Intronic
1118798624 14:69168515-69168537 GGCCCTGCTGAAGCCCTGGAGGG + Intergenic
1119535057 14:75396117-75396139 GTCCCCAGGGAAGCCCAGGAAGG - Intergenic
1119764960 14:77182259-77182281 AGCCCCGGGGAATCCCTGGGTGG - Intronic
1121743134 14:96267887-96267909 AGCCCCGGGGGGACCCTGGAAGG - Intronic
1122494183 14:102140176-102140198 GGCTCCGGTGACGCCCGGGTCGG - Intronic
1122523477 14:102363181-102363203 GGCCCGGGGGAGGCCGAGGAGGG - Intronic
1122770717 14:104096467-104096489 GGCCCTGGGGAGACTCTGGAGGG - Intronic
1122993361 14:105249211-105249233 GCCCCCGGGGGCGACCAGGACGG + Exonic
1123709982 15:22980194-22980216 GGCCCCGCCGCCGCCCTGGCCGG + Intronic
1128109517 15:65067830-65067852 GGACATGGCGACGCCCTGGACGG + Exonic
1128145315 15:65329539-65329561 GGCTCCGGGGACCCTGTGGAGGG + Exonic
1128521108 15:68375485-68375507 GACCCCGGGGCTGCCCTGGCTGG + Intronic
1128582469 15:68819235-68819257 GGGACCGGGGACGCGCTGGCGGG - Intronic
1128739282 15:70072559-70072581 GGCCCTGGTGCAGCCCTGGAGGG - Intronic
1130094020 15:80842889-80842911 GACCCCTGGGACCTCCTGGAAGG - Intronic
1131257486 15:90871822-90871844 GGCCCCGGGGCCGGCCCCGAGGG + Intronic
1132841154 16:1979091-1979113 GGCGCCAGGGCCGCCCTCGAGGG - Exonic
1133223124 16:4327747-4327769 GGCCGCGGGGACCACCGGGACGG - Intronic
1134279277 16:12803587-12803609 GGCCCCGGTGCAGCCCCGGATGG + Intronic
1136141858 16:28293269-28293291 GGCCGCGGGGACGCCGCGGCAGG - Exonic
1136234619 16:28905946-28905968 GGCCCCGGTGGCTCCCTGCAAGG + Intronic
1137613548 16:49834630-49834652 GGCCCCTGGGAAGCCCTGCCAGG - Intronic
1138507559 16:57485916-57485938 GGCCCCGGGGAGGAGCAGGAAGG + Intronic
1141490396 16:84368559-84368581 GTCCCCGGCGAGGCCCGGGATGG - Exonic
1141957878 16:87384383-87384405 AGCCCCGGGGAGGGCTTGGAGGG + Intronic
1141989498 16:87602287-87602309 GGCCCCGGGGAAGCCCAGGGCGG + Intronic
1142291706 16:89196231-89196253 GGCCCCCTGGACACCCTGCACGG - Exonic
1142427534 16:90008671-90008693 GGCCCTTGGGACGTCCTGGGAGG - Intronic
1142471825 17:168973-168995 GCCCCGGGGGAGGCCCTGGCTGG + Intronic
1142549906 17:732306-732328 GGCCCCGCGGCCGCTCGGGAGGG + Intergenic
1142619380 17:1154999-1155021 GGCCCCCAGGGCGCCCGGGAAGG - Intronic
1142713897 17:1737768-1737790 GGACCCAGGGCCTCCCTGGAGGG - Exonic
1142806368 17:2373125-2373147 GGGCCAGGGGACGCCAGGGAGGG + Intronic
1143165173 17:4893943-4893965 GGCCACGGGCAGGACCTGGAGGG + Intronic
1143762546 17:9115767-9115789 GGCGCCGGGGCAGCCTTGGATGG + Intronic
1144944258 17:18961732-18961754 GGCCCCGTGGGGGCTCTGGATGG - Intronic
1145777682 17:27540715-27540737 GCCCCCGTGGGCGCCCTTGAGGG + Intronic
1145787375 17:27603067-27603089 GGCCCCAGGGCCGCCATGGACGG - Intronic
1146058604 17:29593234-29593256 GGCCCCGGGGACGCCGCCGCAGG - Intronic
1148081014 17:44967790-44967812 GGTCCCCGGGAGGCCCCGGAGGG + Exonic
1148139327 17:45317092-45317114 GGCCCCGGGGGCGGCCGAGAAGG - Intergenic
1148867214 17:50634931-50634953 GGCCCCATGGACGCCCTGTGCGG + Exonic
1149336787 17:55643834-55643856 GGCCAATGGGAAGCCCTGGAAGG - Intergenic
1150250222 17:63700640-63700662 GGCTCCGGGGTCGCCCCGGCTGG - Intronic
1151540032 17:74760117-74760139 GGCCCGGGGGAGGGCCTGGCTGG + Intronic
1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG + Intergenic
1152274923 17:79350582-79350604 GGCCCTGGGGACTTCATGGAAGG + Intronic
1152506833 17:80755047-80755069 GCCCCCAGGGACACCCTGGGAGG + Intronic
1152552190 17:81035382-81035404 GGCCCCGGGGCCGCCCTGGTCGG - Intronic
1152609814 17:81310008-81310030 GGCCCTGGGGGCTGCCTGGAGGG - Intergenic
1152612639 17:81323181-81323203 GGCCTCGGGGGAGCCCTGGACGG + Intronic
1152904132 17:82961167-82961189 GTCCTCCGGGACGCCCTGCAGGG + Exonic
1155159703 18:23185586-23185608 AGCCCTGGGGAGGCCCTGGGTGG - Intronic
1155209154 18:23586251-23586273 GGCCACCGGGACGCCCTGTGGGG - Intronic
1156471321 18:37378823-37378845 GGCCCTGGGGACAGCATGGATGG + Intronic
1157329510 18:46693062-46693084 GGCCCTGGGGCTGCCCTGCAGGG + Intronic
1160349747 18:78166675-78166697 GGCCCCGGGGGGTCCCTGGATGG - Intergenic
1160498528 18:79389537-79389559 GGCACCAGGGACGCCCTCCAGGG + Intergenic
1160523901 18:79524457-79524479 GGCAGCGGGAAGGCCCTGGAGGG + Intronic
1160832815 19:1111525-1111547 TGCCCCAGGGATACCCTGGAGGG - Exonic
1160833624 19:1114408-1114430 GTCCCCGAGGTCGCCCTGCAGGG + Exonic
1160894166 19:1395013-1395035 GGGCCCGGGGCTGCCCTGGACGG - Intronic
1160944986 19:1637400-1637422 GGCCCTGGGGTTTCCCTGGAGGG + Intronic
1161072938 19:2271314-2271336 GGCCGCCCGGACGCCCTGGAGGG + Intronic
1161325581 19:3662123-3662145 AGCCCCGGGGACCACCAGGAGGG - Intronic
1161396563 19:4047777-4047799 GGCCCCGGGGCCGCCACCGACGG - Exonic
1161454469 19:4363133-4363155 GGCCCCGGGGACTCCCTCCCTGG - Intronic
1163685870 19:18711322-18711344 GGCCCCGGGGCCGCTTTGAAGGG + Intronic
1164909341 19:31992914-31992936 TGCCCTGGGGACACCCTGTAAGG + Intergenic
1165157073 19:33795555-33795577 GGCTCCAGGGACGCCCGGGCCGG - Intergenic
1165172784 19:33905904-33905926 GTCCCCAGGGACACCCTGGCAGG - Intergenic
1166048455 19:40243448-40243470 GGCCCGCAGGACTCCCTGGAGGG + Intronic
1166858002 19:45792753-45792775 GGCCCGGGGGGCGCCCAAGATGG - Exonic
1166996787 19:46723233-46723255 GGCCACGGGGACGCCGTGTGGGG - Exonic
1167145780 19:47680306-47680328 CGCCCCCGGCTCGCCCTGGATGG - Exonic
1167269475 19:48499201-48499223 GGCGCCGGGGAGACCCTGGCGGG - Exonic
1167492697 19:49801509-49801531 GGCCCGCAGGACGCCCTGGATGG - Exonic
1168294631 19:55372813-55372835 GGCCCCTGGGGGGCCCTGAAAGG - Intergenic
1168304747 19:55429391-55429413 GGGGCTGGGGAGGCCCTGGAAGG + Exonic
1168315710 19:55483906-55483928 GGCCCCGGGGAGGCGGGGGATGG + Exonic
1168339343 19:55614543-55614565 GGGCCCGAGGACACCGTGGAGGG - Exonic
1202703943 1_KI270713v1_random:6756-6778 GGCCCTGGGCCAGCCCTGGAAGG + Intergenic
925640116 2:5979147-5979169 GGCCCAGGGCACACCCAGGAGGG + Intergenic
927812157 2:26186218-26186240 CACCCCGGGGAGGCACTGGAGGG - Exonic
933791736 2:85888786-85888808 GGCCCCCGCGACGCCGAGGAGGG + Intronic
934301711 2:91780518-91780540 GCCCACGGGGAAGCCCTGGCGGG - Intergenic
936091173 2:109502187-109502209 GGCCCTGGGGGTGCCCCGGAAGG + Intronic
937459846 2:122076219-122076241 GGCCCCAGGGACACCTTAGATGG - Intergenic
945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG + Intronic
946308824 2:218871649-218871671 GGCCCCGCGGGCTCCCCGGAAGG + Exonic
946684875 2:222257818-222257840 GACCCTGGGGAGGCCCTGGTGGG - Intronic
948462691 2:238138042-238138064 GGCCTCGGGGCTGCCCAGGACGG - Intergenic
948559906 2:238845914-238845936 GGCCCCGGGGACGCCCTGGAAGG - Intergenic
1169557782 20:6768329-6768351 GGACCCGGCGTCGCCCAGGATGG + Exonic
1171011104 20:21510030-21510052 AGCCCCGGGCACGCCCGGGAAGG - Intergenic
1176088006 20:63306840-63306862 GGACCCGAGGACCCTCTGGAGGG - Intronic
1180211157 21:46296088-46296110 GGCCCTGGGGTGGCCCTGAAGGG + Intronic
1180219556 21:46349558-46349580 GGGCCCGGGGGCGCCCAGGATGG + Intronic
1180247868 21:46560609-46560631 GCCCCCGGGGACACCCAAGAAGG - Intronic
1180766128 22:18346715-18346737 GGCCCCGAGGGAGGCCTGGAGGG - Intergenic
1180780185 22:18515663-18515685 GGCCCCGAGGGAGGCCTGGAGGG + Intergenic
1180812901 22:18772984-18773006 GGCCCCGAGGGAGGCCTGGAGGG + Intergenic
1180814721 22:18782201-18782223 GCCCACGGGGAAGCCCTGGCGGG + Intergenic
1180983251 22:19889260-19889282 GGCCCAGAGGACCCCCAGGAAGG + Intronic
1181032433 22:20154986-20155008 GGCGCCCGGGACACCCTGGATGG + Intergenic
1181199079 22:21207300-21207322 GGCCCCGAGGGAGGCCTGGAGGG + Intergenic
1181278794 22:21703781-21703803 GGGCCCTGGGACGGCCTGGATGG - Intronic
1181400683 22:22648556-22648578 GGCCCCGAGGGAGGCCTGGAGGG - Intergenic
1181648707 22:24247332-24247354 GGCCCCGAGGGAGGCCTGGAGGG + Intergenic
1181690325 22:24555478-24555500 GGCCTCGGGGATGCACTGGGCGG - Intronic
1181700835 22:24620436-24620458 GCCCACGGGGAAGCCCTGGCGGG - Exonic
1182355769 22:29721626-29721648 AGCCCAGGGGAAGCCATGGAGGG + Intronic
1183347257 22:37314744-37314766 GGCCCAGGGGAGCCCCTGGAGGG + Exonic
1183504637 22:38202370-38202392 CGTCCCGGGGACGCCGAGGACGG + Intronic
1183622759 22:38984015-38984037 AGCCCCGAGGACTCCCGGGAGGG + Intronic
1183966650 22:41446472-41446494 TGGCCCGGCGACGCCCGGGAAGG - Exonic
1185198962 22:49490632-49490654 GGCCTGGAGGAGGCCCTGGAAGG + Intronic
1203226009 22_KI270731v1_random:78898-78920 GCCCACGGGGAAGCCCTGGCGGG - Intergenic
1203227746 22_KI270731v1_random:87606-87628 GGCCCCGAGGGAGGCCTGGAGGG - Intergenic
1203264818 22_KI270734v1_random:7888-7910 GCCCACGGGGAAGCCCTGGCGGG + Intergenic
950656421 3:14439817-14439839 TACTCCGGGGACTCCCTGGAGGG + Intronic
954297878 3:49684280-49684302 GGCCCTGGGCCAGCCCTGGAAGG - Intronic
954756270 3:52842008-52842030 GGGCCCTGGGACAGCCTGGAGGG - Intronic
957062215 3:75491159-75491181 GTCCCAGTGGAAGCCCTGGAAGG + Intergenic
960937603 3:122913110-122913132 AGCCCCGGGGAGGCCCAGGCCGG - Intronic
961211405 3:125128823-125128845 GACCCAGGGGACGCCTAGGAGGG + Intronic
961291180 3:125848245-125848267 GTCCCAGCGGAAGCCCTGGAAGG - Intergenic
961895974 3:130167929-130167951 GTCCCAGCGGAAGCCCTGGAAGG + Intergenic
963046253 3:141104676-141104698 GGCTCCCAGGACGCCCTGGCAGG - Intronic
964852108 3:161105594-161105616 GGCCTCGAGGCGGCCCTGGAGGG + Intronic
968008766 3:195259887-195259909 GGCCCCGGGGAGGACCAGGCAGG + Intronic
968592524 4:1466113-1466135 GGCCCCGAGGAGGCCGTGGCAGG - Intergenic
968764730 4:2462470-2462492 GGCCCCGGCGGCGCCCTCGCAGG + Exonic
968879586 4:3292384-3292406 GGGCCCCGGGACGCCCGCGAAGG - Intergenic
969006114 4:4021244-4021266 GTCCCAGCGGAAGCCCTGGAAGG + Intergenic
969806834 4:9616046-9616068 GTCCCAGCGGAAGCCCTGGAAGG - Intergenic
970320202 4:14867882-14867904 GGGCCAGGGGAAGCCCTGGATGG - Intergenic
982351085 4:154416235-154416257 GGCCCCGAGGACAGCCTGGAAGG + Intronic
987303301 5:16616571-16616593 GGCCCCGGGGACCCAGTGCAGGG - Intronic
995804757 5:116038948-116038970 GGCCCCAGGGACTCCCTGAAAGG - Intronic
997335609 5:133107087-133107109 GGCCCTGGGTAGGCCCTGGCAGG - Intergenic
997727460 5:136133251-136133273 GGCGTCTGGGACGCCCTGGAGGG + Intronic
997980436 5:138464960-138464982 GGATCCGGGGACGCCCAGGCGGG - Intergenic
998385246 5:141753650-141753672 GCCCCCGGGGCCGCACTGGAAGG - Intergenic
998385250 5:141753661-141753683 GGCCCCGGGGGCTCCCGGGCTGG + Intergenic
999300003 5:150485507-150485529 GGCCCTGGGAACGCTCTGGCTGG - Intergenic
1003641218 6:7877153-7877175 GACCCCAGAGAAGCCCTGGAGGG - Intronic
1004512254 6:16292492-16292514 GGCCTCGGGGGCTACCTGGAAGG - Intronic
1005947147 6:30602894-30602916 GGCCCCCAGGACCCCCTGGTGGG + Exonic
1005989988 6:30896723-30896745 GCCCCCGGTGACGCCCTGCAGGG - Exonic
1006981941 6:38154247-38154269 GGCCCTGGGGAGGGCCGGGAAGG - Exonic
1007278125 6:40690546-40690568 GGCACCGGGGAGGCCGTGGCTGG - Intergenic
1007506948 6:42342947-42342969 GGCCCCAGAGAGGCCTTGGATGG - Intronic
1011565100 6:88665331-88665353 GTCCCCAGAGAAGCCCTGGAAGG + Intronic
1012401868 6:98848062-98848084 GGCCCCTGGGACGCCCAGCCAGG + Intergenic
1019437106 7:1028039-1028061 GTCCCCGAGCAGGCCCTGGACGG - Intronic
1019525887 7:1480330-1480352 GGCCCTGAGGACGACCTGGCTGG - Exonic
1019537650 7:1537577-1537599 GGTCCCGGGGACGGCCAGGTGGG - Intronic
1019588569 7:1817563-1817585 TGCCCAGGGGATGTCCTGGAGGG + Intronic
1019592791 7:1844176-1844198 GTCCCCGGGGAGCCCCTGGCAGG - Intronic
1019597355 7:1864314-1864336 GGCCCCGGGTCTGCCCTGCAGGG - Intronic
1019712771 7:2525013-2525035 GGGGGCGGGGCCGCCCTGGAAGG + Intronic
1022207479 7:28179421-28179443 GGCCCGGGAGACGCCGGGGAGGG - Intronic
1023955588 7:44884699-44884721 GGCCCAGGGGGCGGCCTGTATGG - Exonic
1029640159 7:101815649-101815671 GGCCCCGAGGGGGCGCTGGAGGG - Intergenic
1033042127 7:137928245-137928267 GGCGCCGGGGACGTCGGGGAAGG + Exonic
1033369476 7:140695706-140695728 GGGCCCGGGGTCAGCCTGGAGGG + Intronic
1034977970 7:155458891-155458913 GACCCCGGCGGCCCCCTGGACGG + Exonic
1035559917 8:596513-596535 GGCCTCAGGGACGCCATGGCTGG + Intergenic
1035600342 8:893570-893592 GGCCCCAGGGCCACACTGGATGG - Intergenic
1036369961 8:8154387-8154409 GTCCCAGCGGAAGCCCTGGAAGG - Intergenic
1036390303 8:8318883-8318905 GGGCCCGGGGCCGGCCTGGAGGG + Exonic
1036454342 8:8893810-8893832 GGCTCCGGGGCCCCCCTGGTGGG + Intergenic
1036880931 8:12511243-12511265 GTCCCAGCGGAAGCCCTGGAAGG + Intergenic
1037879579 8:22566219-22566241 GACCCGGGAGACGCCCTGGGAGG + Intronic
1048178341 8:132172679-132172701 GGACCCCAGGATGCCCTGGAGGG + Exonic
1048865848 8:138760947-138760969 GACCCCAGGGAGGGCCTGGAGGG + Intronic
1049273422 8:141708032-141708054 GGTCCCTGGGACGGCCTGGAGGG + Intergenic
1049353639 8:142177305-142177327 GGCCCAGGGGCAGCCTTGGAGGG - Intergenic
1049805580 8:144537306-144537328 GGCCCAGGGGCAGCCCTGGGCGG + Intronic
1053045971 9:34917624-34917646 GGCCCCGGGAAGCCACTGGAAGG - Intergenic
1053153312 9:35756653-35756675 GGTCCAGGGGACATCCTGGAAGG + Exonic
1053434842 9:38068041-38068063 GGGGCCGGGGACCCCCTGGGGGG - Exonic
1054194403 9:62015906-62015928 GGCCCAGGGGAGGCCCTCAAGGG - Intergenic
1054644004 9:67572784-67572806 GGCCCAGGGGAGGCCCTCAAGGG + Intergenic
1056591193 9:87967361-87967383 GGCCATGGGGAGGCCTTGGAGGG + Exonic
1057199912 9:93134350-93134372 GGCCCCGGGCCCGCCCCGGGTGG - Intergenic
1057802363 9:98198163-98198185 GGCCCCGTGGTGGCCCTGGCTGG - Intergenic
1057891778 9:98875116-98875138 GGCCCAAGGCATGCCCTGGAGGG - Intergenic
1059234495 9:112750685-112750707 GGCGCCGCGGCCGCCCGGGAGGG - Intergenic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060966782 9:127716117-127716139 GGCCTCGGGGTCCTCCTGGAAGG + Exonic
1061247198 9:129406543-129406565 GTCACCGGGCACGCCCTGCAGGG - Intergenic
1062272079 9:135714319-135714341 GGCCCCGGGGCCGCTTTGGAGGG + Intronic
1062548847 9:137077002-137077024 GGCCCCAGGGACGCCCCGCAGGG - Intergenic
1186357041 X:8800378-8800400 AGCCCCAGGGACGGGCTGGACGG - Intronic
1186378433 X:9033238-9033260 AGCCCCGGGGACGGGCTGGACGG - Intronic
1186795526 X:13044008-13044030 AGCCCCGGGGAAGCGCTGGACGG - Intronic
1192457095 X:71285161-71285183 GGCCCCGGAGAGGCCCAGGATGG - Intronic
1200117538 X:153775947-153775969 GGCCCCGTGGACGCCGTGACAGG + Exonic