ID: 948560594

View in Genome Browser
Species Human (GRCh38)
Location 2:238848815-238848837
Sequence TCTCCTCGGCGAGGCCCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948560580_948560594 29 Left 948560580 2:238848763-238848785 CCGCTGCGGGGGGCGGGCGGCAG 0: 1
1: 0
2: 2
3: 25
4: 280
Right 948560594 2:238848815-238848837 TCTCCTCGGCGAGGCCCCGCGGG 0: 1
1: 0
2: 0
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948560594 Original CRISPR TCTCCTCGGCGAGGCCCCGC GGG Intronic
902581992 1:17413642-17413664 TCTGCTCTGCGTGGCCCAGCCGG + Exonic
902600770 1:17539373-17539395 TCTCCGCGGGGAGACCCCGCAGG - Intergenic
903830134 1:26169726-26169748 CCTCCCCAGCGAGGGCCCGCGGG + Intergenic
905874205 1:41422071-41422093 GCTCCTCGGGGAGGGCCGGCTGG + Intergenic
908462292 1:64357229-64357251 TCTCCTCTGCGAGGCACTGTTGG - Intergenic
908721923 1:67134778-67134800 TCTCCCGGTCCAGGCCCCGCTGG + Intronic
911637370 1:100249862-100249884 TCTCCTCGGCGCGGCCTATCAGG + Intergenic
913412201 1:118564388-118564410 TCTCCCCTGCCAGGCCCTGCAGG - Intergenic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
919991028 1:202708993-202709015 CCACCTGGGAGAGGCCCCGCAGG + Intronic
921811762 1:219523141-219523163 TCGCCTCAGCGAGGCACCTCAGG + Intergenic
924540025 1:244971292-244971314 TCCCCTGGGAGAGGCCCGGCCGG - Intronic
924624820 1:245689024-245689046 TGTCCCCGGCGGAGCCCCGCGGG - Intronic
1067572926 10:47384665-47384687 CCGCATCGCCGAGGCCCCGCGGG - Intergenic
1070742824 10:78913729-78913751 GCTCCTCGGCGGGGCACCTCGGG + Intergenic
1071579408 10:86756320-86756342 GCTCCTCCGCGCGGGCCCGCCGG - Intergenic
1076912614 10:133399286-133399308 TCTCCTTGGAGAGGCCAGGCAGG - Intronic
1077192999 11:1263289-1263311 CCTCCTTGCCGAGGCCCAGCAGG + Intergenic
1078146779 11:8727122-8727144 TCTCCAAGGCAAGTCCCCGCAGG + Intronic
1082733436 11:56827729-56827751 TCTGTTCTGCCAGGCCCCGCAGG + Intergenic
1083952750 11:65965907-65965929 GCTCCACGGTGAGGCCCTGCAGG - Exonic
1094338962 12:29389521-29389543 TCTCCCCGACGGGACCCCGCCGG + Intergenic
1102254419 12:111407360-111407382 TCTCCCCGGCGAGGGGCTGCGGG - Intronic
1103308845 12:119989067-119989089 TCTCCTCAGCGACGCCCAGGTGG - Intergenic
1106249083 13:27970607-27970629 TCACTGCGGCGAGGCCCGGCGGG + Exonic
1113427295 13:110219102-110219124 ACTCTGTGGCGAGGCCCCGCCGG + Intronic
1113695603 13:112343278-112343300 CCTCCCCGGCCTGGCCCCGCGGG - Intergenic
1113800181 13:113082420-113082442 TCTCCGCGGCGTAGCCCTGCAGG - Exonic
1117828445 14:59727126-59727148 CCGGCTCGGCCAGGCCCCGCCGG + Exonic
1118736790 14:68706735-68706757 TCTCCTCCTCTAGGCCCAGCAGG + Intronic
1119709678 14:76812699-76812721 TCGCCTCTGCGGGGCTCCGCGGG - Intronic
1120020504 14:79524906-79524928 TCTACACGGCCAGGCCTCGCTGG - Intronic
1122942042 14:104985848-104985870 CCGCCTCGGCGGGGCCGCGCGGG - Exonic
1132754168 16:1474670-1474692 GCTCCTCGGCGGGGCCGGGCTGG - Intronic
1137444621 16:48524089-48524111 TCTCCAGGGCCAGGCCCCTCTGG - Intergenic
1142130832 16:88430809-88430831 TCTTCTCGCCTCGGCCCCGCCGG - Exonic
1142671990 17:1491676-1491698 TCTCCCCGCCCAGGGCCCGCCGG + Intronic
1147161817 17:38572933-38572955 CTCCCTCGGCGCGGCCCCGCCGG + Intronic
1152345460 17:79748263-79748285 TCTCCGCGGCCGGGCCCTGCGGG + Intergenic
1152390966 17:80003396-80003418 TCCCCAGGGGGAGGCCCCGCTGG + Intronic
1152720775 17:81922952-81922974 CCTCCTTGGACAGGCCCCGCAGG + Exonic
1160868513 19:1266644-1266666 TCTCCATGGCGACGCCCCGCAGG + Intronic
1160961813 19:1725532-1725554 GCTCCGCGGCGCGGTCCCGCAGG + Intergenic
1161003180 19:1921375-1921397 TCTACACAGCTAGGCCCCGCTGG - Intronic
1162101317 19:8340853-8340875 TGTCCTCTGCGATGACCCGCTGG - Intronic
1162561827 19:11421751-11421773 TTTCCTCCACGAGGCCCAGCAGG + Exonic
1162943487 19:14028341-14028363 TCTCCACCGGGAGCCCCCGCAGG - Exonic
1163847111 19:19643909-19643931 GCTCCTGGGAGAGGCCCCCCGGG - Intergenic
1164740928 19:30575262-30575284 TCTCCTTTGCTATGCCCCGCCGG + Intronic
1165446834 19:35861214-35861236 CCTCCGCGGCGCCGCCCCGCAGG - Exonic
1165779775 19:38425711-38425733 TCTCCTGGGCCAGGCCCTGCAGG + Intronic
1166885892 19:45960829-45960851 TCTGCTCGGCCAGGCCCCTCGGG + Intronic
1167536976 19:50059891-50059913 TCTCCCCGGTGTGGCACCGCTGG + Intergenic
1167741424 19:51326807-51326829 ACTCCCCGGCCTGGCCCCGCTGG - Exonic
925376247 2:3388186-3388208 TGTCCTGGCCGAGGCCTCGCTGG - Exonic
927847928 2:26480860-26480882 TCTCCACAGCCAGGCCCAGCAGG + Exonic
927971297 2:27307553-27307575 TCTGCTCGGCGCGCTCCCGCTGG + Exonic
929254091 2:39790753-39790775 TCTGTTCTGCCAGGCCCCGCAGG + Intergenic
931218451 2:60267381-60267403 TCTCCTCTGCGTGCCCCGGCTGG - Intergenic
931515234 2:63047468-63047490 GCTTTTCGGCGAGGCCCCTCGGG - Intergenic
938453969 2:131445934-131445956 TCTCCTCCGGGAAGCCCCCCAGG - Intergenic
945119676 2:206444115-206444137 TTTCCTCTGCAGGGCCCCGCGGG - Intronic
946422026 2:219570674-219570696 CGTCCTCGGCGCGGCCCGGCTGG + Exonic
948560594 2:238848815-238848837 TCTCCTCGGCGAGGCCCCGCGGG + Intronic
948675516 2:239594466-239594488 TCTGCTCGGAGAGGCCTCGTAGG + Intergenic
1169488360 20:6052220-6052242 CCGCCTCGGCGATGCCCCCCTGG + Exonic
1172293214 20:33790788-33790810 TCTCCTCAGAGATGCCACGCTGG - Intronic
1172484883 20:35292103-35292125 GCTCCTCGGAGATGACCCGCAGG + Exonic
1179209600 21:39313774-39313796 TCTCCTCATCGAGTCCCCGGAGG - Exonic
1180109727 21:45642445-45642467 CCACCCCGGCGAGGACCCGCGGG + Intergenic
1184864729 22:47195785-47195807 GCTCCTCGGCCAGGGCCCGAGGG + Intergenic
954324537 3:49856219-49856241 CCTCCTAGACGAGGCCCCACGGG - Intronic
961335916 3:126179803-126179825 TCTCCTAGGCAAGTGCCCGCGGG + Intronic
968434153 4:576323-576345 CCTCCTGGGAGGGGCCCCGCGGG - Intergenic
969361111 4:6664313-6664335 TCTCCTCGCCAAGCCTCCGCGGG + Intergenic
976827701 4:89279014-89279036 TCTCCTCGTCAAGGCCCAACTGG - Intronic
979278231 4:118836378-118836400 TTTTCTCGGCGCAGCCCCGCAGG + Intronic
985523228 5:388904-388926 TCTCCTGTGCGAGGCACCGGCGG - Intronic
986402880 5:7396329-7396351 CCTCCTCGGAGCGGTCCCGCAGG - Exonic
994180954 5:96765517-96765539 TCCCCTCAGGGAGGCTCCGCTGG - Intronic
1000203453 5:159034572-159034594 TCTCCTCTGTCAGGCCTCGCTGG - Intronic
1002784969 6:393386-393408 CCTCCCCGGCGCGCCCCCGCCGG - Intronic
1003324712 6:5083574-5083596 TCTCATCGCCAAGGCCCCACAGG - Intergenic
1007701719 6:43769921-43769943 CCTCCTCGCCAATGCCCCGCGGG + Intergenic
1013372462 6:109482983-109483005 CCTCCCCGCCCAGGCCCCGCGGG + Intronic
1017737678 6:157380108-157380130 TCTCCTCGGCGCAGGCCTGCGGG + Intergenic
1019003651 6:168778004-168778026 TGTCCTAGGCGATGCCTCGCTGG - Intergenic
1019538297 7:1540024-1540046 CCTCCTTGGTGAGACCCCGCAGG - Exonic
1025777186 7:64569861-64569883 ACTCCCCGGCCTGGCCCCGCAGG + Intergenic
1034202907 7:149293591-149293613 TCTCCTGGGCGAGGCTCCTGAGG + Intronic
1034508984 7:151519404-151519426 GCTCCCAGGCGAGGCCCCGGCGG + Intronic
1036786799 8:11693030-11693052 ACTCCACGCAGAGGCCCCGCAGG - Intronic
1039884264 8:41646392-41646414 GCTCCTCGGCGTCCCCCCGCAGG + Exonic
1048833432 8:138497300-138497322 TCTCCGCCGCGAGGCCCTGATGG + Intergenic
1051641875 9:19230958-19230980 CCTCCTCGGCGACCCCCCGCGGG - Intronic
1053016553 9:34665442-34665464 CCTCGACGGCGAGGCACCGCGGG - Intronic
1059470960 9:114504801-114504823 TCTCCACGCCGAGGCCCGGCCGG + Exonic
1060269652 9:122131706-122131728 GCTCCTCGGAGAGGCCCAGTCGG + Intergenic
1060555152 9:124504325-124504347 GCGCCAAGGCGAGGCCCCGCAGG + Intronic
1062642132 9:137524423-137524445 TCTCCTCGTGAAGGCCTCGCAGG + Intronic
1187547249 X:20266509-20266531 TCTCCTCCTCGCGCCCCCGCCGG - Intronic
1190059054 X:47199269-47199291 TCTCCACGCCCAGGCCCCGCAGG - Exonic
1199723776 X:150562749-150562771 CCTCCTTGAGGAGGCCCCGCTGG - Intergenic