ID: 948561493

View in Genome Browser
Species Human (GRCh38)
Location 2:238856793-238856815
Sequence GTTGTTTTTCTGAGAACGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948561493_948561496 -3 Left 948561493 2:238856793-238856815 CCTGCCGTTCTCAGAAAAACAAC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 948561496 2:238856813-238856835 AACACTGTGAAAATCCAGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 219
948561493_948561502 29 Left 948561493 2:238856793-238856815 CCTGCCGTTCTCAGAAAAACAAC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 948561502 2:238856845-238856867 ACTGCTGCAATAGTGCCACGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
948561493_948561495 -4 Left 948561493 2:238856793-238856815 CCTGCCGTTCTCAGAAAAACAAC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 948561495 2:238856812-238856834 CAACACTGTGAAAATCCAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 171
948561493_948561503 30 Left 948561493 2:238856793-238856815 CCTGCCGTTCTCAGAAAAACAAC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 948561503 2:238856846-238856868 CTGCTGCAATAGTGCCACGAGGG 0: 1
1: 0
2: 2
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948561493 Original CRISPR GTTGTTTTTCTGAGAACGGC AGG (reversed) Intronic
900906620 1:5564057-5564079 GTTGTTTTCCTGTGAACAGGAGG - Intergenic
901394368 1:8970236-8970258 TTTGTTTTTCTGAAAATGTCAGG - Intronic
902760388 1:18576988-18577010 CTTGTCTTTCTGAGAAGGCCTGG + Intergenic
905006507 1:34714235-34714257 GTTGTTTTCCTGGCAACAGCGGG - Intronic
909487767 1:76192623-76192645 GTTTTGTTTCTGAGGACAGCTGG + Intronic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
912750783 1:112285637-112285659 GTGGTTCTTCTGAGCCCGGCAGG - Intergenic
916705543 1:167345566-167345588 ATTGTGTTTCTGAGGAAGGCAGG + Intronic
917860368 1:179138069-179138091 CTTGTATTTCTGAAAACAGCTGG + Intronic
920232419 1:204479474-204479496 GTTGTTTTTCTGATACAGGATGG - Intronic
1065204664 10:23345057-23345079 ATTGTTTTTCTGTAAACGACTGG + Intergenic
1066704048 10:38158122-38158144 CTTGTTTTTCTGACATTGGCTGG - Intergenic
1070793225 10:79202045-79202067 TTTTTTTTTTTGAGAACGACTGG - Intronic
1072077937 10:91997351-91997373 GTTTTTCTTCTGAGGAAGGCTGG - Intronic
1072504396 10:96049934-96049956 GATGTTTTTCTGAAAACACCTGG + Intronic
1074456311 10:113598573-113598595 GGTGTTTTTATGAGAACAGAGGG - Intronic
1079173170 11:18115561-18115583 GTTGTTTTTATGGGGACGGTTGG + Intronic
1086403204 11:86477907-86477929 GTTGTTCTTCTGAGAACATGGGG + Intronic
1087066607 11:94033319-94033341 GTTGAATTTCTGAGAGCAGCTGG + Intronic
1092584334 12:9880977-9880999 TTTGTTTTTCAGAAAACGCCAGG - Intergenic
1096436372 12:51593314-51593336 GTTGTGTTTCTGAGTAGAGCTGG + Intronic
1096479246 12:51927106-51927128 GTTGTTTTTCTGTTAAATGCTGG - Intergenic
1096785664 12:54015909-54015931 GAAATTTTTCTGAGAAAGGCAGG + Intronic
1097760982 12:63463751-63463773 GTTTCTTTTCAGAGAACTGCTGG - Intergenic
1100683042 12:96950062-96950084 GTTATTTATATGAGAACTGCAGG - Intronic
1108281401 13:48865778-48865800 GGTGTTTTGCTGAGAATGGAAGG + Intergenic
1114362880 14:21994961-21994983 GTTGTTTTCCTCAAAATGGCAGG + Intergenic
1119201469 14:72755944-72755966 GTTGTTTATCTCAGAACAGGAGG + Intronic
1125675671 15:41501449-41501471 GTGGTTTTTCTGAAAGCGACAGG - Exonic
1138330737 16:56213504-56213526 GGTGTTTTTCTGAGATGGGATGG + Intronic
1139168970 16:64607615-64607637 CATATTTTTCTGAGAAAGGCTGG - Intergenic
1142240901 16:88944549-88944571 GTTGTTTTCCTGAGGGCAGCAGG - Intronic
1142622485 17:1173709-1173731 GTTGGTTGTCTGAGTACGGGTGG - Intronic
1148853692 17:50567150-50567172 ATTGTTTTTCTGAGTAGAGCCGG - Intronic
1151000050 17:70365082-70365104 GTTGTCTTTCCCAGAAAGGCTGG - Intergenic
1155912224 18:31517098-31517120 GTTGTTTTGCTGCAAATGGCAGG - Intronic
1157580158 18:48769413-48769435 GCTGTTTTTCTAAAAATGGCTGG + Intronic
1158528017 18:58232815-58232837 GTTGTTTTTCTGAGAGTTGAGGG + Intronic
1160107516 18:75991988-75992010 GTTGTTTTTCACAGAAGGGGTGG + Intergenic
1166573142 19:43811959-43811981 GTTGTTCTTCTGATATGGGCTGG + Intronic
925993928 2:9276455-9276477 GATGTTATTCTGAGAACACCAGG + Intronic
926880211 2:17537315-17537337 TTTGTTTTTCTGAGAGAGACAGG - Intergenic
927023714 2:19043815-19043837 GCTGTTGTTCTGAGAACTGGAGG - Intergenic
927907886 2:26875122-26875144 GTTGCTTTTCTGAGAACTGGAGG - Intronic
929981097 2:46681220-46681242 GATGTTTTATTGAGAAAGGCTGG - Intergenic
933061770 2:77746911-77746933 AATGTTTTTCTGTAAACGGCAGG + Intergenic
933098594 2:78221436-78221458 GTTGCTTTTTTGAGATCAGCTGG + Intergenic
933764195 2:85695859-85695881 TTTGTGTTTCTGAGGCCGGCAGG - Intronic
938858170 2:135337682-135337704 GTTGTTTTTCTGGTAACTGGGGG - Intronic
939826318 2:147019678-147019700 GTTGTTTTTCTTGAAATGGCAGG - Intergenic
943288296 2:186033985-186034007 GTTGTGTTTCTGAGACTAGCTGG + Intergenic
944770933 2:202912972-202912994 GTTGTTTTTCTGAGGGAGGATGG + Intronic
945774570 2:214089137-214089159 GTTGTTTTTTTGGGCACTGCTGG + Intronic
946970729 2:225087969-225087991 GTTGTTTTTCTGACACCTGAAGG - Intergenic
948189786 2:236048984-236049006 CTTGTGTTTCTAAGAACGGTTGG + Intronic
948561493 2:238856793-238856815 GTTGTTTTTCTGAGAACGGCAGG - Intronic
1169468177 20:5859796-5859818 GTTGTTTCTCTGAAGACGACTGG + Intronic
1181715645 22:24725512-24725534 GTGGTTTTTCTGTGAACAGGTGG - Exonic
1183238347 22:36637242-36637264 ATTGTTTTTCTGAGAAGCCCAGG - Intronic
949891733 3:8738293-8738315 TTTGTTTTTCTGAAGAAGGCAGG - Intronic
954863801 3:53712198-53712220 ATTGTCTTTCTGAGATCTGCAGG + Intronic
956858989 3:73303938-73303960 GTTGGTTTTCTGAGAGCTGTGGG + Intergenic
959509845 3:107198435-107198457 GATGTTTTTCTAAGAATGTCTGG - Intergenic
962629600 3:137262979-137263001 GTTGTTTTTCTGGGATTGGCAGG - Intergenic
963803762 3:149702323-149702345 GTTGTCTGTCTCAGAATGGCAGG + Intronic
964355419 3:155847231-155847253 TTTGTTTTTCTGAGAATGTAGGG + Intronic
966517246 3:180831429-180831451 GTTGTTTTTCTTGAAACGACAGG - Intronic
966750297 3:183315628-183315650 GTTTTAATTCTGAGAACAGCTGG + Intronic
972519157 4:39837385-39837407 GTTGTTTTTCTGGGCAGGGTGGG + Intronic
974800895 4:66816485-66816507 GTTGTTTTTCTTATAATGACAGG + Intergenic
974877082 4:67714154-67714176 TTTTTTTTTCTGATAAAGGCTGG - Intergenic
982071420 4:151698568-151698590 GTTGTGTTTCTGATGAAGGCAGG + Intronic
982112365 4:152068500-152068522 GTTTCTATTCTGAGAATGGCAGG - Intergenic
983161487 4:164421051-164421073 GTTGTGTCTCTGAGAATAGCAGG - Intergenic
987873690 5:23651817-23651839 GCAGTTTTTCTGAGAAATGCAGG + Intergenic
988348150 5:30067235-30067257 GTTTGTTTTCTGAGAATTGCAGG + Intergenic
989988636 5:50734315-50734337 TTTCTTTTTCTGAAAAGGGCTGG - Intronic
991062745 5:62395980-62396002 TTTCTTTTTCTGAGACAGGCTGG - Intronic
992749438 5:79848978-79849000 GCTGCTTTTCTGAGAGAGGCAGG - Intergenic
993015189 5:82527475-82527497 GTTGTTGTGCTGAGAACAGGAGG - Intergenic
995958786 5:117813779-117813801 GTTGTTTTTCTTTAAACGGCAGG - Intergenic
1000599468 5:163254447-163254469 GAGGTTTTTCTGAGAATGGCTGG - Intergenic
1006660303 6:35636344-35636366 GGTGTTTTTCTGAGAATGAATGG - Intronic
1010572755 6:77497623-77497645 GATGTTTTTCGGAGAATGACAGG - Intergenic
1018069419 6:160149343-160149365 ATTGTTTTTTTGAGACAGGCTGG + Intronic
1018670183 6:166170442-166170464 CTTGTTTTTCTCTGAATGGCTGG - Intergenic
1019664597 7:2245332-2245354 GTTTTTGTTCTGAGAAAGGTAGG + Intronic
1025699555 7:63805063-63805085 TTTGTTTTTTTGAGACAGGCTGG + Intergenic
1026662921 7:72317743-72317765 GTTCTTTTTCTTAGAAAGACTGG - Intronic
1028898345 7:96067039-96067061 GTTTTATTTCTGCTAACGGCAGG + Intronic
1030495294 7:110291221-110291243 GGAGTTTCTCTGAGAACTGCTGG - Intergenic
1031585873 7:123532484-123532506 GTTGTTTTTCTGAGGGAGGATGG - Exonic
1031828690 7:126599550-126599572 CTTGCTTCTCTGAGAACGGAAGG + Intronic
1033205099 7:139413224-139413246 TTTTTTTGTCTGAGAAAGGCAGG + Intronic
1034560345 7:151876150-151876172 GTTGTTTTGCTGAAAAGGGACGG - Intronic
1037009942 8:13829156-13829178 GTTCATTTTCTGAGAATGTCGGG + Intergenic
1039944328 8:42116836-42116858 ACTCTTTTTCTGAGAAAGGCAGG + Intergenic
1042520610 8:69707567-69707589 GTTGTATTTCTGATAATGGAGGG + Intronic
1044051043 8:87504779-87504801 GTTGATCTGCTGAGAATGGCAGG - Intronic
1045219139 8:100179968-100179990 GTTGTTTTTCTTAAAGCGACAGG - Intronic
1047232033 8:123005707-123005729 GTGCTATTTCTGAGAAAGGCTGG - Intergenic
1048328658 8:133457558-133457580 TTCTTTTTTCTGAGAAAGGCTGG - Exonic
1049184649 8:141243407-141243429 TTTGTTTTTCTGACAGCGGAAGG - Intronic
1050785914 9:9401561-9401583 CTTGTTTTACAGAGAAAGGCTGG - Intronic
1051057696 9:13007487-13007509 GATGTTTGTCTGAGAACAGATGG + Intergenic
1052791547 9:32879682-32879704 GTTGGTTTTCTGAGGATAGCAGG + Intergenic
1053513463 9:38709178-38709200 CTTGTTTTGCTGAAAACTGCTGG + Intergenic
1186160510 X:6772565-6772587 TTTGTTTTTCTGGGAATGGCTGG - Intergenic
1189774827 X:44461312-44461334 TTTGTTTTTCTGATAACTTCAGG - Intergenic
1192419072 X:71012775-71012797 TTTGTTTTTCAGAGATAGGCTGG + Intergenic
1194195766 X:90890140-90890162 ATTATTTTTATGAGAACTGCAGG - Intergenic
1195583128 X:106531601-106531623 GTGGTTTTTCTGATTATGGCTGG + Intergenic
1196087654 X:111702804-111702826 GTAGCTTTTCTGAGAAAGGGTGG + Intronic