ID: 948562939

View in Genome Browser
Species Human (GRCh38)
Location 2:238866077-238866099
Sequence CAGTAACACCAGATGCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948562939_948562950 29 Left 948562939 2:238866077-238866099 CCACACTGCATCTGGTGTTACTG 0: 1
1: 0
2: 1
3: 9
4: 174
Right 948562950 2:238866129-238866151 CCATTTCACCTGCTGCCAGCAGG 0: 1
1: 0
2: 1
3: 27
4: 228
948562939_948562942 -5 Left 948562939 2:238866077-238866099 CCACACTGCATCTGGTGTTACTG 0: 1
1: 0
2: 1
3: 9
4: 174
Right 948562942 2:238866095-238866117 TACTGGGACCCACTGAATGTAGG 0: 1
1: 0
2: 1
3: 27
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948562939 Original CRISPR CAGTAACACCAGATGCAGTG TGG (reversed) Intronic
901875326 1:12164163-12164185 CAGGGACAGCAGAGGCAGTGTGG - Intergenic
905872798 1:41414812-41414834 CAGGGACAGCACATGCAGTGTGG - Intergenic
907047961 1:51311538-51311560 CAGCAACATCAGATGCACTGTGG + Intronic
908259296 1:62327311-62327333 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
914974621 1:152349868-152349890 CAGTGCAACCATATGCAGTGGGG - Exonic
917742207 1:177971623-177971645 CTGTAACACCAGCTGCATTATGG + Intronic
917742607 1:177975682-177975704 CAGCAACATCTGATGCATTGTGG + Intronic
920975324 1:210780495-210780517 GTGGAACAGCAGATGCAGTGGGG + Intronic
921067675 1:211634099-211634121 CAGCAAGACCACAGGCAGTGTGG + Intergenic
921828999 1:219706218-219706240 AAGAAACAACAGATGCCGTGAGG + Intronic
922041650 1:221903671-221903693 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
923004472 1:230035815-230035837 CAGAAAGGCCAGAAGCAGTGGGG - Intergenic
923933136 1:238726510-238726532 CAGTGACACCAGAGGAAGGGAGG + Intergenic
924679777 1:246220235-246220257 CCATCACACCAGCTGCAGTGAGG + Intronic
1063470692 10:6282508-6282530 CCGTAGCAGCAGATGTAGTGAGG + Intergenic
1065519598 10:26558798-26558820 CAGAAACAACAGAAGCAATGAGG + Intronic
1071107284 10:82112970-82112992 CAGGAAGACCAGGAGCAGTGTGG - Intronic
1071664211 10:87538047-87538069 CAGTGACTCCAGAAGCAGAGGGG - Intronic
1073568516 10:104556257-104556279 CAGAAACTCCAGATGTAATGTGG - Intergenic
1073670223 10:105579705-105579727 CAGTACAACCAGCTGCAGAGAGG - Intergenic
1079343907 11:19635328-19635350 CAATTACTCCAGCTGCAGTGTGG + Intronic
1080180919 11:29425182-29425204 CAGTAAGAGCAGTTTCAGTGGGG - Intergenic
1080593384 11:33744320-33744342 CACAAACAGCAGATGCAGAGAGG + Intronic
1080740462 11:35059163-35059185 CAGTGAGAGCAGTTGCAGTGAGG + Intergenic
1081163931 11:39785805-39785827 CAGGATCACCAGCTGCAGAGAGG - Intergenic
1081164185 11:39786964-39786986 CTGTGGCACCAGCTGCAGTGGGG - Intergenic
1084222853 11:67695248-67695270 AAGCAACACCAGCTGCAGTGAGG + Intergenic
1085450711 11:76630416-76630438 CAGGAACAGCAAATGCAGAGAGG - Intergenic
1087222582 11:95562478-95562500 CATTGACAGGAGATGCAGTGTGG + Intergenic
1088478913 11:110273769-110273791 CAGAAACAGCAAATGAAGTGTGG - Intronic
1089024024 11:115249420-115249442 CAACAACACCGGATGAAGTGAGG - Intronic
1093552781 12:20435181-20435203 CAGTAACAAGGAATGCAGTGGGG - Intronic
1093562760 12:20562086-20562108 CAGTAATACCAAATGAAGTCAGG + Intronic
1094085113 12:26581931-26581953 CAGTTGCAGAAGATGCAGTGTGG - Intronic
1098036862 12:66312157-66312179 CAGAAACGCCAGTTGAAGTGTGG + Intronic
1099703502 12:86119847-86119869 AAGAAAAGCCAGATGCAGTGGGG - Intronic
1103173535 12:118843151-118843173 CTGAGACACCAGCTGCAGTGGGG + Intergenic
1103677196 12:122665072-122665094 CTGTCACCCCAGCTGCAGTGTGG - Intergenic
1104482739 12:129122272-129122294 CAGACATACCAGATGCTGTGGGG + Intronic
1109592158 13:64499648-64499670 GAGAAACACCAGATGCAGATAGG - Intergenic
1110430782 13:75420737-75420759 AAGTTACACCAAATGTAGTGGGG + Intronic
1113383079 13:109821272-109821294 CAGGAAGAGCAGATGCAGGGAGG - Intergenic
1117864956 14:60137401-60137423 AAGAAAAACCAGATGCAGTTAGG + Exonic
1117930741 14:60838574-60838596 CAAAGACACCAGCTGCAGTGGGG + Intronic
1118522143 14:66596897-66596919 CAATGACACCAGATGCAGTGGGG - Intronic
1119668470 14:76500768-76500790 CAGCAACACTAGATCCAGTGAGG - Exonic
1120671318 14:87365697-87365719 CAGTGGGACCAGATGCAGTTTGG - Intergenic
1120847898 14:89142343-89142365 CAGGAACACTAGGTGCAGAGTGG + Intronic
1121393786 14:93599904-93599926 CATTAAAACCAGATGCAGCTGGG + Intronic
1121485618 14:94312365-94312387 CAGTAAACCCAGGTGCAGGGAGG - Intronic
1124019072 15:25903343-25903365 CAGTAATAACCGTTGCAGTGGGG + Intergenic
1126393427 15:48184548-48184570 CATTAACATCAGATGTACTGGGG + Intergenic
1126543024 15:49842792-49842814 TAGTAAATCCAGATGGAGTGAGG - Intergenic
1127258814 15:57312973-57312995 CAGAAACACCAGAGGCACCGGGG + Intergenic
1128081223 15:64858085-64858107 TAGCGACCCCAGATGCAGTGTGG + Intronic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1136872821 16:33824290-33824312 CAGGAAGACCAGCTGCAGGGAGG - Intergenic
1137304969 16:47189914-47189936 CAATAACACCTAATGCAGTTTGG - Intronic
1137921169 16:52489973-52489995 GGGTAACTCCAGGTGCAGTGTGG - Intronic
1138096853 16:54218708-54218730 CAGAGACAGCAGGTGCAGTGGGG + Intergenic
1138342634 16:56300585-56300607 GAGTAACCCCAGATTCAGTCTGG - Intronic
1138452233 16:57100198-57100220 CAGTAAAACCAAATGCAGCCGGG - Intronic
1138837106 16:60451064-60451086 AAGTAACACCTAATGCAGTTGGG + Intergenic
1139373847 16:66484660-66484682 CAGGAGTACCAGATGGAGTGAGG + Intronic
1203099350 16_KI270728v1_random:1291764-1291786 CAGGAAGACCAGCTGCAGGGAGG + Intergenic
1144473569 17:15564981-15565003 CAGTAACATCAAGTGCATTGAGG - Intergenic
1144922953 17:18779830-18779852 CAGTAACATCAAGTGCATTGAGG + Intergenic
1147467184 17:40619374-40619396 CAGTAATAAAAGATGCAGTATGG - Intergenic
1148224542 17:45889517-45889539 AATTAATACCAGAGGCAGTGGGG + Intergenic
1148830437 17:50427193-50427215 CAGCAACATCAGATGGGGTGTGG + Intronic
1152530421 17:80915317-80915339 CAGGAAAACCAGCTGCAGAGAGG + Intronic
1152890379 17:82878171-82878193 CAGGACCACCAGATGCCATGCGG - Intronic
1155272050 18:24150178-24150200 GAGCAACACCAAATGCAGTTTGG - Intronic
1161483998 19:4525057-4525079 CAGATAGACCACATGCAGTGTGG - Exonic
1163374606 19:16922495-16922517 CAGGGACCCCAGATGTAGTGTGG - Intronic
1166182472 19:41118564-41118586 CAGGTACACCAGATGCAAAGAGG + Intronic
925289881 2:2740411-2740433 GAGGAACACCAGCTGGAGTGAGG + Intergenic
926156708 2:10459032-10459054 CAGGAAGGCCAGAAGCAGTGCGG - Intergenic
926625469 2:15086207-15086229 CAGGAAGACCAGTTGCAGAGAGG + Intergenic
928401622 2:30983096-30983118 CAGTAACACCAAGGGCAGTGTGG - Intronic
933405612 2:81854186-81854208 CAGAAAAACCAAATACAGTGTGG + Intergenic
934699901 2:96430789-96430811 CAGTATGACCAGCTGCAGAGAGG + Intergenic
936125241 2:109783703-109783725 CAGGAAGGCCAGATGCAGGGTGG + Intergenic
936219452 2:110587765-110587787 CAGGAAGGCCAGATGCAGGGTGG - Intergenic
938405378 2:131029988-131030010 CTGTGACACCAGATGGTGTGAGG + Intronic
938710848 2:133975263-133975285 CAGTGACACCTGCTCCAGTGGGG - Intergenic
939599838 2:144174918-144174940 CAGTAAAACCAAAAACAGTGAGG + Intronic
940778195 2:157906166-157906188 CATTAAAACCACATGGAGTGTGG - Intronic
941007266 2:160261013-160261035 AAGTAACACCTGGTGCACTGGGG + Intronic
941519953 2:166529623-166529645 CAATAACACAATATGAAGTGTGG - Intergenic
943172395 2:184419296-184419318 GAGAAACATCAGAAGCAGTGGGG + Intergenic
943747202 2:191474688-191474710 CAGTAACACCAGATGTGGATGGG - Intergenic
943999340 2:194812345-194812367 CAGTAACAGCAGATGCTGCTAGG + Intergenic
944172274 2:196793130-196793152 GAGAAACATCAGATGGAGTGAGG - Exonic
944304539 2:198164535-198164557 CAGTAACAACAGATACATTTGGG - Intronic
947890735 2:233617008-233617030 CAGATACATCACATGCAGTGGGG - Intergenic
948562939 2:238866077-238866099 CAGTAACACCAGATGCAGTGTGG - Intronic
1168983546 20:2027471-2027493 CCATGACACCAGCTGCAGTGGGG - Intergenic
1170792966 20:19522726-19522748 CAGCAACACCAGTTGCAGAGAGG - Intronic
1173529327 20:43756566-43756588 CTGTGACTCCAGCTGCAGTGGGG + Intergenic
1173932924 20:46836895-46836917 GAATAACACCAGAAGCAGTTGGG + Intergenic
1174065907 20:47866032-47866054 CAGCATGACCAGATGCAGAGAGG + Intergenic
1176240479 20:64073649-64073671 CAGGAACTCCAGGTGCAGGGCGG - Exonic
1176312535 21:5160415-5160437 CCATAACAGGAGATGCAGTGTGG - Intergenic
1178640339 21:34340203-34340225 CTGGAACACCATCTGCAGTGTGG + Intergenic
1179844513 21:44101615-44101637 CCATAACAGGAGATGCAGTGTGG + Intronic
1181044405 22:20207769-20207791 CAGTGACACCACCTGCAGAGAGG + Intergenic
1185071880 22:48661156-48661178 CAGTGACCCCAACTGCAGTGTGG - Intronic
1185207533 22:49548726-49548748 CAGTAGCCCCAGATTCAGAGAGG - Intronic
949949564 3:9217912-9217934 CAGGAGAGCCAGATGCAGTGGGG - Intronic
958513960 3:95088439-95088461 CATTAACTGCAGAAGCAGTGTGG - Intergenic
961476914 3:127152776-127152798 CATCAACACCAGACACAGTGGGG - Intergenic
962712327 3:138098403-138098425 GAGAAACACCAGAGGCAGAGAGG + Intronic
968232657 3:197012709-197012731 GACTAACGCCAGATGCAGAGGGG - Intronic
968552364 4:1230148-1230170 CTGGTGCACCAGATGCAGTGTGG + Intronic
969134562 4:5019743-5019765 CAGGAACAGCAGATGGAGAGGGG + Intergenic
969153518 4:5190483-5190505 CCATGACACCAAATGCAGTGTGG - Intronic
969477607 4:7430449-7430471 CGGCCACACCAGATGCAGAGGGG - Intronic
972623946 4:40777726-40777748 CAGTATCTCCAGATACACTGTGG - Intronic
975195742 4:71521266-71521288 CAGTAACCCAAGCTGGAGTGCGG + Intronic
982518893 4:156388324-156388346 CCTTAACACCAGATAAAGTGAGG + Intergenic
982901163 4:161003930-161003952 CAGTGATGCCAGCTGCAGTGGGG - Intergenic
984741970 4:183173686-183173708 CAGGCACCCAAGATGCAGTGTGG + Intronic
985710379 5:1424461-1424483 CAGTGACACCATGGGCAGTGAGG - Intronic
985964371 5:3328634-3328656 CAAAAACACCAGATGCTGGGAGG - Intergenic
986329958 5:6710779-6710801 CAGCAACACCAGAAGCTGAGAGG + Intergenic
986572463 5:9179805-9179827 CTGTAAGAGCAGATGCAGTGTGG + Intronic
988110058 5:26807987-26808009 CAGGCACATCAGTTGCAGTGGGG - Intergenic
991716646 5:69457092-69457114 TAGCAACACCGGATGCAGAGAGG + Intergenic
991731060 5:69588694-69588716 TAGCAACACCGGATGCAGAGAGG + Intronic
991807492 5:70443853-70443875 TAGCAACACCGGATGCAGAGAGG + Intergenic
991863890 5:71039158-71039180 TAGCAACACCGGATGCAGAGAGG - Intronic
993295350 5:86131529-86131551 CAGTAACACCAGAGAGAGTAAGG - Intergenic
994946807 5:106404605-106404627 CAGTAGCAGGAGATGCAGGGAGG + Intergenic
996891162 5:128422300-128422322 CAAGAACACCAAATGCAATGAGG + Intronic
999885150 5:155914296-155914318 GAGTAACACTAGATGCTGGGAGG - Intronic
1000029735 5:157391191-157391213 CAGTGACAGCAGAGGCACTGAGG + Intronic
1000398858 5:160803995-160804017 CAGTAACTCCAGTTCCAGTCAGG - Intronic
1001769956 5:174287447-174287469 CAGAAACACCAAATAAAGTGAGG + Intergenic
1003439923 6:6130902-6130924 CAATAAAAGCAGATGCAGTCTGG - Intergenic
1004279870 6:14271473-14271495 CAGGAAGACCAGCTGCAGAGGGG - Intergenic
1013740896 6:113283428-113283450 AAGTAACAACAGATGTTGTGAGG + Intergenic
1014016051 6:116531349-116531371 GTGAAACACCAGAAGCAGTGAGG + Intronic
1019832418 7:3346085-3346107 CAGTATCACAAGTTGCAATGTGG - Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021270168 7:18575030-18575052 CCATGACACCAGCTGCAGTGGGG - Intronic
1021625346 7:22587600-22587622 CAGGAAGCCCAGATGCTGTGTGG - Intronic
1021860289 7:24899282-24899304 CAGTATTAACAGTTGCAGTGTGG - Intronic
1021874914 7:25039483-25039505 CATAACCACCAAATGCAGTGTGG - Intergenic
1022082399 7:27035607-27035629 AAATAAGACCAGGTGCAGTGTGG - Intergenic
1023513712 7:40979536-40979558 AAGTTTCACCAGATGCAGTCAGG - Intergenic
1023529418 7:41137052-41137074 CAGGGACGCCAGCTGCAGTGGGG - Intergenic
1023694554 7:42831325-42831347 CAGTGAAACAAGATTCAGTGTGG + Intergenic
1023699914 7:42882793-42882815 CAGGCATACCAGCTGCAGTGGGG + Intergenic
1025024306 7:55503876-55503898 CAGCAATACCAGAGGCTGTGGGG - Intronic
1025110708 7:56213808-56213830 CAGTAGCTCCAGAGGCTGTGTGG + Intergenic
1030084602 7:105805767-105805789 CAGCAAGAGCAAATGCAGTGTGG + Intronic
1031786705 7:126041732-126041754 CAGGCACACCAGCTGTAGTGGGG - Intergenic
1037057884 8:14467025-14467047 CAGTAAAACCCGAGGAAGTGAGG - Intronic
1037691916 8:21188584-21188606 CACTAGCACCAAATGCAGAGGGG - Intergenic
1038282597 8:26179693-26179715 CAGTAAGCCCAGTTGCAGTACGG + Intergenic
1038382740 8:27112311-27112333 CAGTAACAACAGGTGAAGTCAGG + Intergenic
1038584941 8:28779834-28779856 CAGTTACACCAGAAGCACTGGGG - Intronic
1042396090 8:68293040-68293062 CAGTAGAACCAGATGCAAAGAGG + Intergenic
1043750298 8:83926263-83926285 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
1044952981 8:97451630-97451652 CAATGGCACCAGATGGAGTGAGG - Intergenic
1048163078 8:132038679-132038701 CAGTCACTCCAGCTCCAGTGAGG + Intronic
1048332802 8:133482547-133482569 AAGTGAAAGCAGATGCAGTGGGG - Intronic
1048944361 8:139430501-139430523 CAGTAGCACCACTTGCAATGGGG + Intergenic
1050120119 9:2299382-2299404 CAGCCACACAAGCTGCAGTGTGG - Intergenic
1051029779 9:12659203-12659225 CCATGACACCAGCTGCAGTGGGG - Intergenic
1051143487 9:14003137-14003159 CACTGACACCAGCAGCAGTGTGG - Intergenic
1051859510 9:21608494-21608516 CTGTAAGACCAAATGTAGTGAGG + Intergenic
1052552689 9:29970449-29970471 CCGTGACACCAACTGCAGTGTGG - Intergenic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1055644676 9:78351720-78351742 CAGTACCACCAGGTGTAGTAGGG - Intergenic
1058545936 9:106060095-106060117 GCGTAACACCGGCTGCAGTGGGG - Intergenic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1186889315 X:13944651-13944673 AAGCAACATCAGATCCAGTGGGG - Intergenic
1187865204 X:23717466-23717488 CACTCACACAAGAGGCAGTGAGG + Intronic
1190369271 X:49726361-49726383 CTGTCACTCCAGCTGCAGTGGGG + Intergenic
1192265307 X:69533651-69533673 CAGGATGACCAGCTGCAGTGAGG - Intergenic
1194316001 X:92379025-92379047 CCATGACACCAGCTGCAGTGGGG + Intronic
1194427710 X:93760414-93760436 CAGTAGCAACAGAGGCAGAGCGG + Intergenic
1200624050 Y:5490599-5490621 CCATGACACCAGCTGCAGTGGGG + Intronic