ID: 948563326

View in Genome Browser
Species Human (GRCh38)
Location 2:238868096-238868118
Sequence ACCTTTGTGGGGCACTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948563326_948563339 21 Left 948563326 2:238868096-238868118 CCAGTGCAGTGCCCCACAAAGGT 0: 1
1: 0
2: 0
3: 15
4: 127
Right 948563339 2:238868140-238868162 CCGTGCCCTGGGTTCCCTCTGGG 0: 1
1: 0
2: 0
3: 11
4: 209
948563326_948563334 10 Left 948563326 2:238868096-238868118 CCAGTGCAGTGCCCCACAAAGGT 0: 1
1: 0
2: 0
3: 15
4: 127
Right 948563334 2:238868129-238868151 ACACATCAGCCCCGTGCCCTGGG 0: 1
1: 0
2: 0
3: 13
4: 151
948563326_948563333 9 Left 948563326 2:238868096-238868118 CCAGTGCAGTGCCCCACAAAGGT 0: 1
1: 0
2: 0
3: 15
4: 127
Right 948563333 2:238868128-238868150 CACACATCAGCCCCGTGCCCTGG 0: 1
1: 0
2: 2
3: 16
4: 190
948563326_948563337 20 Left 948563326 2:238868096-238868118 CCAGTGCAGTGCCCCACAAAGGT 0: 1
1: 0
2: 0
3: 15
4: 127
Right 948563337 2:238868139-238868161 CCCGTGCCCTGGGTTCCCTCTGG 0: 1
1: 0
2: 1
3: 26
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948563326 Original CRISPR ACCTTTGTGGGGCACTGCAC TGG (reversed) Intronic
900611209 1:3545353-3545375 ACCCTTCTGAGGGACTGCACAGG + Intronic
904431960 1:30470114-30470136 ACCCCTGTTGGGCCCTGCACAGG + Intergenic
906767063 1:48443331-48443353 AGCTTTGTGGGGCACTGATAGGG - Intronic
907128946 1:52077793-52077815 ACCTTTGCTGGGCTCTGCATAGG - Intronic
909509761 1:76438832-76438854 ACCTTTCTGGAGTACTGGACAGG + Intronic
912527166 1:110291999-110292021 ACCTTTGGGGGACAGTGCAGGGG - Intergenic
916084171 1:161256620-161256642 AGCTTTGTGGGGCACTGATAGGG - Intergenic
923898431 1:238299216-238299238 AGCTTTGAGGAGCACTGGACTGG - Intergenic
1065891792 10:30127535-30127557 CCCTTTGTGGGGCTTTGCAAAGG + Intergenic
1066656892 10:37704937-37704959 ACCTGAGTGGGACCCTGCACAGG + Intergenic
1067977595 10:51043349-51043371 TGCTTTGGGGGGCACGGCACAGG - Intronic
1068846972 10:61687967-61687989 ACCTTTGAGGGGTTCTGAACAGG - Intronic
1069532642 10:69230453-69230475 ACCTTTGGGAGACTCTGCACTGG + Intronic
1069653363 10:70068499-70068521 ACAGCTGTTGGGCACTGCACAGG + Intronic
1071341628 10:84653963-84653985 ACAGGTGTGGGCCACTGCACTGG + Intergenic
1080639386 11:34149913-34149935 ACCGTCTTGGGCCACTGCACAGG + Intergenic
1083200386 11:61118014-61118036 TCCCTTCTGGGGCACTGCAGGGG - Intronic
1084495779 11:69502225-69502247 ACCTCTGTGCGCCACTCCACAGG + Intergenic
1085467939 11:76736918-76736940 ACCAGTGTGGGGCACCCCACAGG + Intergenic
1086420148 11:86630814-86630836 TACTCTGTGTGGCACTGCACAGG - Intronic
1086638908 11:89126504-89126526 ACCCTTGTGGGTCCCTGCACAGG + Intergenic
1087843326 11:102942631-102942653 ACAGGTGTGGGCCACTGCACTGG - Intergenic
1088854927 11:113740310-113740332 ACAGTTGTGAGCCACTGCACCGG - Intronic
1091638874 12:2219179-2219201 CCCTTTGTGGAGCTCTGCCCTGG + Intronic
1092199756 12:6573072-6573094 ACCTTTGTGCAGGACTGCATTGG + Exonic
1097943197 12:65335501-65335523 AACTGTGTGTGGCACTGGACTGG - Intronic
1102593757 12:113976772-113976794 AGTTTTGAGGGGCACTGCCCAGG - Intergenic
1104204065 12:126619372-126619394 ACATTTGTGGAGCCATGCACAGG + Intergenic
1105565645 13:21544926-21544948 ACACTTGTGAGCCACTGCACCGG + Intronic
1105805957 13:23951669-23951691 ACCCTTCTGGGACACTGCAGAGG + Intergenic
1107238253 13:38198976-38198998 TCCTTTATGGGGTACTGAACAGG + Intergenic
1111698806 13:91660359-91660381 ACTTATGTGGGCCACTCCACAGG - Intronic
1112888257 13:104200425-104200447 ACATGTGTGAGCCACTGCACTGG + Intergenic
1114426494 14:22628399-22628421 ACCTTTGTGGGGCAGTTTTCTGG + Intergenic
1114426645 14:22629426-22629448 ACCTTCCAGGGGCACTCCACCGG + Intergenic
1115431080 14:33319535-33319557 ACCTATGTGAGGCACTGTGCTGG + Intronic
1118266408 14:64298792-64298814 ACCTTTGAGGGGCAGTGGACAGG - Intronic
1119912590 14:78363606-78363628 ACCTGAGTGGAGCACTGCAATGG - Intronic
1131504838 15:93008294-93008316 ACCTCTGAGCGGGACTGCACAGG - Intronic
1132215711 15:100060275-100060297 ACTTCTGTGGGGCACCACACGGG + Intronic
1133486958 16:6229006-6229028 ACAATTGTGGGGCACAGCAGGGG - Intronic
1134273388 16:12754554-12754576 ACCTTAGAGGGACTCTGCACTGG - Intronic
1134609589 16:15597830-15597852 ACCCTAGGGGGGCACTGCACAGG + Intronic
1138961683 16:62036078-62036100 ACTCTTGTGGGGCCCTGCGCTGG + Exonic
1139551424 16:67675167-67675189 ACCTGTGTGAGGCACTTCAGCGG - Exonic
1139598057 16:67969274-67969296 GCCTTTTTGGGACAGTGCACTGG + Intronic
1141252879 16:82374769-82374791 ATGTTTGTGGAGCACTGCAATGG + Intergenic
1145083700 17:19917386-19917408 ACCTTTGTGAGGCATTGGCCAGG - Intronic
1147633230 17:41946154-41946176 ACCTTCGGGGGGCACTCCACTGG - Intronic
1148347909 17:46915971-46915993 ACCTGTGTGGGTCAATGCCCTGG + Intergenic
1149769561 17:59309524-59309546 ACAAGTGTGAGGCACTGCACCGG - Intergenic
1150047596 17:61928463-61928485 ACCTTAGAGAGGCAATGCACGGG + Intergenic
1154150576 18:11903308-11903330 ACCTTCTGGGGGCACTCCACAGG + Intronic
1157915078 18:51656400-51656422 ACCTTCTGGGGGCACTCCACCGG - Intergenic
1159143671 18:64426522-64426544 ACCTATGTGTGTCTCTGCACGGG - Intergenic
1160203121 18:76811360-76811382 ACAGGTGTGGGCCACTGCACTGG + Intronic
1160689723 19:455975-455997 ACCTGTGTGGGGCACAGCAACGG - Intronic
1162415228 19:10532053-10532075 ACAGATGTGGGCCACTGCACCGG + Intergenic
1162760966 19:12887834-12887856 ACCCTTGGGTGGCACTGCATGGG + Intergenic
1163819602 19:19488435-19488457 ACCTTTGTGGTTCTCTGAACAGG - Intronic
1164086563 19:21907941-21907963 ACCCTTGTGGGGCAGTGCCAAGG - Intergenic
1165013381 19:32864368-32864390 CCCCTTGTGAGGCACTGCCCCGG + Intronic
1166893750 19:46010317-46010339 ACCTGTCTGGTTCACTGCACAGG - Intronic
1168614466 19:57826693-57826715 ACCTGCGTGGTGCACTACACCGG - Intronic
925570880 2:5311428-5311450 GCATTTGTTGAGCACTGCACTGG + Intergenic
927150252 2:20191461-20191483 AGCCTTGTGTGGCACTGTACTGG + Intergenic
927442283 2:23127755-23127777 AGCTCTGTGGGGCACAGCCCAGG - Intergenic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
928163761 2:28954086-28954108 ACATGTGTGAGCCACTGCACTGG + Intergenic
929689772 2:44064562-44064584 ACAGGTGTGGGACACTGCACAGG - Intergenic
932670963 2:73737621-73737643 ACCTGTGTTGGGCGTTGCACCGG + Intergenic
933369469 2:81396818-81396840 ACCTTCTGGGGGCACTGCACTGG + Intergenic
933686262 2:85143896-85143918 ACCCCTCTGGGGCACTGCACTGG - Intronic
938142741 2:128810071-128810093 ACCTTTGTGAGTCACTGGTCTGG + Intergenic
939624215 2:144456996-144457018 ACCTTTGGGGGGTGCTGCTCTGG - Intronic
943331184 2:186561150-186561172 ACCTTTGTGGTTCCTTGCACTGG - Intergenic
947045215 2:225974615-225974637 ACCTTTGAGACCCACTGCACAGG - Intergenic
948563326 2:238868096-238868118 ACCTTTGTGGGGCACTGCACTGG - Intronic
948585725 2:239018461-239018483 ACCCTTGATGGGCACTGCATGGG - Intergenic
1168904560 20:1392833-1392855 ACCTGCGTGGTGCACTACACCGG - Exonic
1172939359 20:38644021-38644043 ACCTTTGTTGGCCTCTGCACAGG + Intronic
1173457472 20:43215233-43215255 TCCTCTGTGGGACACTGCCCTGG + Intergenic
1174854717 20:54032584-54032606 ACCTATGTGTGTCACTGCATAGG - Intronic
1175736770 20:61392593-61392615 CCCTTTATGGGGCACTGCTCAGG - Intronic
1177987382 21:27993770-27993792 ACATTTGTGGGGCTCAGGACAGG + Intergenic
1178070470 21:28960447-28960469 TCCTTTGTGGGGGATTGCATGGG - Intronic
1181476378 22:23170129-23170151 TACTTTTTGGGGAACTGCACAGG - Intergenic
1182495926 22:30707436-30707458 ACCGGTGTGAGCCACTGCACTGG - Intronic
950118811 3:10468277-10468299 CCCTTAGTGGGGCACAGTACAGG + Intronic
956465099 3:69512185-69512207 ACCATAGTGAGGCACTGCACGGG + Intronic
961953180 3:130771916-130771938 CCCTATGTGGGGCAATGCATAGG - Intergenic
962354134 3:134679221-134679243 ACCTGTCTTGAGCACTGCACAGG - Intronic
962742127 3:138369574-138369596 AGCATTGTGGGGCACTGAAAGGG + Intronic
964319803 3:155482942-155482964 ATCTTTGTGGAGCAGAGCACTGG + Exonic
966782462 3:183595513-183595535 GACTTTCTGGGGCACTCCACAGG + Intergenic
966881525 3:184353699-184353721 ACCTGCGTTTGGCACTGCACAGG - Exonic
967762299 3:193240417-193240439 AACTTTATGGAGCGCTGCACAGG - Intergenic
969855963 4:9999825-9999847 ACACTTGGGGGGCACTGCAGTGG + Intronic
972797114 4:42432507-42432529 ACCATGGTGGGACACTGCAGAGG + Intronic
973579744 4:52331465-52331487 AACTTTGTGGGGAACTGCTGGGG - Intergenic
973930549 4:55789348-55789370 ACCTTTTGGGGACACTCCACTGG - Intergenic
979066366 4:116139986-116140008 ACCTTTGTGGAGCTCTGAACTGG - Intergenic
985957322 5:3275271-3275293 ACCTTTCTGGGTCTCTTCACCGG + Intergenic
986948227 5:13049652-13049674 ACCTTCCAGGGGCACTCCACTGG + Intergenic
988274645 5:29065241-29065263 ACCTTTCAGGGGCACTCCACTGG - Intergenic
990800626 5:59598800-59598822 ACATGTGTGAGCCACTGCACTGG - Intronic
995495954 5:112743378-112743400 ATCTTTGTGGGGCCATACACAGG + Intronic
997648099 5:135494511-135494533 TCCTTTGTGTGGAGCTGCACAGG + Intergenic
997990778 5:138543046-138543068 ACCTTTGTGGCGAGCTGCACCGG - Intronic
999240769 5:150126209-150126231 ACCTTTGAGGTGGACTGCATGGG - Intronic
1002062201 5:176631959-176631981 ACCATAGTGTGGCATTGCACTGG - Intronic
1003125631 6:3353707-3353729 ACATTTGGGTGGCAGTGCACAGG - Intronic
1005390084 6:25324114-25324136 TCCTTTGTGGGGCATTAAACAGG - Intronic
1008043365 6:46826482-46826504 ACCTTGTTGGGACAATGCACAGG + Exonic
1009399647 6:63238984-63239006 ACCATTGTGGGTAACTGGACTGG - Intergenic
1015113664 6:129621462-129621484 GCCTCCATGGGGCACTGCACAGG + Intronic
1016720347 6:147289008-147289030 ACCTTCGGGGGGCACTCCACTGG - Intronic
1019995407 7:4721249-4721271 GCCTGTGTGTGGCAGTGCACAGG + Intronic
1024386914 7:48762259-48762281 ACATTGGTGGGGCTCTGCTCTGG - Intergenic
1024853058 7:53744032-53744054 AACTTTATGGGGAACTCCACAGG + Intergenic
1026352156 7:69526774-69526796 ACCTTATAGGGGCACTCCACCGG + Intergenic
1026818330 7:73529622-73529644 ACAGTTGTGAGCCACTGCACTGG + Intergenic
1027987025 7:85306294-85306316 ACCTAAGTGGGGCATGGCACAGG - Intergenic
1030232518 7:107223209-107223231 CCCTTTGTGGGGCAGGGCACAGG + Intronic
1034418930 7:150978996-150979018 CCCTCTGTGGGGCTCTGCATAGG + Intergenic
1037293282 8:17374207-17374229 ACAGATGTGAGGCACTGCACCGG - Intronic
1039276435 8:35938078-35938100 AGCTTTGAGGGGCACTGCTAGGG - Intergenic
1040280128 8:46036596-46036618 ACAGTTGTGAGCCACTGCACTGG - Intergenic
1040415962 8:47196388-47196410 ACCCTTGTGGGCCACTGGAAAGG - Intergenic
1040933563 8:52760565-52760587 ACCTTTGTGGGCCACTGTGTGGG + Intergenic
1042667404 8:71221830-71221852 ACCTTCTGGGGGCACTCCACTGG + Intronic
1043870091 8:85422728-85422750 GCCTTTGTGTGTCTCTGCACAGG + Intronic
1048452336 8:134544284-134544306 GCCTGTGCTGGGCACTGCACTGG - Intronic
1048863428 8:138740870-138740892 ACCTTTGAGAGGCACTGGAATGG - Intronic
1050580540 9:7050674-7050696 CCTTCTGAGGGGCACTGCACTGG - Intronic
1051187817 9:14479229-14479251 ACCCTTGTGGGGGATTGCAGGGG + Intergenic
1061231531 9:129318636-129318658 ACCTTTCTGGAGCCCTGCAGTGG - Intergenic
1061801686 9:133116379-133116401 GCCTTTGCGGGGCTCAGCACTGG - Intronic
1062276758 9:135735024-135735046 GCCGTTCTGGGGCACTCCACAGG + Intronic
1186863306 X:13694583-13694605 ACATTTGTAGGGCACCCCACTGG - Intronic
1194460307 X:94158599-94158621 ACCTTTGCGGATCTCTGCACTGG - Intergenic
1194648109 X:96482919-96482941 ACCTTCTGGGGGCACTCCACCGG - Intergenic
1195219373 X:102731884-102731906 ACCTTCTGGGGGCACTCCACTGG - Intronic