ID: 948565706

View in Genome Browser
Species Human (GRCh38)
Location 2:238884802-238884824
Sequence GCCGGAAAGTGCCTGCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948565699_948565706 16 Left 948565699 2:238884763-238884785 CCCGCAGGTCAGGAGCACAGGGA 0: 1
1: 1
2: 5
3: 46
4: 402
Right 948565706 2:238884802-238884824 GCCGGAAAGTGCCTGCTCCCTGG 0: 1
1: 0
2: 1
3: 17
4: 130
948565696_948565706 19 Left 948565696 2:238884760-238884782 CCTCCCGCAGGTCAGGAGCACAG 0: 1
1: 0
2: 0
3: 15
4: 193
Right 948565706 2:238884802-238884824 GCCGGAAAGTGCCTGCTCCCTGG 0: 1
1: 0
2: 1
3: 17
4: 130
948565700_948565706 15 Left 948565700 2:238884764-238884786 CCGCAGGTCAGGAGCACAGGGAG 0: 1
1: 0
2: 6
3: 46
4: 395
Right 948565706 2:238884802-238884824 GCCGGAAAGTGCCTGCTCCCTGG 0: 1
1: 0
2: 1
3: 17
4: 130
948565694_948565706 28 Left 948565694 2:238884751-238884773 CCTCGCAGGCCTCCCGCAGGTCA 0: 1
1: 0
2: 1
3: 15
4: 152
Right 948565706 2:238884802-238884824 GCCGGAAAGTGCCTGCTCCCTGG 0: 1
1: 0
2: 1
3: 17
4: 130
948565704_948565706 -8 Left 948565704 2:238884787-238884809 CCTTCCGGAAGCATGGCCGGAAA 0: 1
1: 0
2: 0
3: 3
4: 50
Right 948565706 2:238884802-238884824 GCCGGAAAGTGCCTGCTCCCTGG 0: 1
1: 0
2: 1
3: 17
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948565706 Original CRISPR GCCGGAAAGTGCCTGCTCCC TGG Intronic
901014629 1:6221416-6221438 GCTGGGAAGTGCCTACTCTCTGG - Exonic
903466936 1:23558438-23558460 GGCGGAAACTGACTGCTCCTTGG - Intronic
903670791 1:25034261-25034283 GCCTGAAAGTCCCTGTTCTCAGG + Intergenic
906149880 1:43581523-43581545 ACCTGAAAGGCCCTGCTCCCTGG + Intronic
907043470 1:51284217-51284239 GTCGGAAAGTGCCTTCTGCTCGG - Intergenic
909197687 1:72648480-72648502 GCTCAGAAGTGCCTGCTCCCCGG + Intergenic
911139418 1:94482680-94482702 GCTTCAAAGTGCCAGCTCCCAGG - Intronic
911906351 1:103573153-103573175 GCTGGAAAGTCCCTACTTCCAGG - Exonic
911909825 1:103619001-103619023 GCTGGAAAGTCCCTACTTCCAGG - Exonic
911912922 1:103657884-103657906 GCTGGAAAGTCCCTACTTCCAGG - Exonic
911913705 1:103668156-103668178 GCTGGAAAGTCCCTACTTCCAGG + Intronic
911915533 1:103694064-103694086 GCTGGAAAGTCCCTACTTCCAGG + Exonic
911920334 1:103752023-103752045 GCTGGAAAGTCCCTACTTCCAGG - Exonic
913450502 1:118989547-118989569 GCCGGAAAGAGCTGGGTCCCGGG + Exonic
923397737 1:233583860-233583882 GCAGGAAAGGGCAGGCTCCCTGG + Intergenic
1063767268 10:9156772-9156794 GCCGGAAATTGCTTGAACCCAGG - Intergenic
1069627405 10:69876823-69876845 ACCCCAAAGTCCCTGCTCCCAGG + Intronic
1070334110 10:75439388-75439410 GCAGGAAAGTGCTTGGGCCCTGG - Intronic
1072151276 10:92686728-92686750 GCTGGAAAGTGCTTGAACCCGGG - Intergenic
1073063046 10:100743658-100743680 GCCGAAAAGTAACAGCTCCCAGG - Intronic
1075090721 10:119442693-119442715 GCGGCAGCGTGCCTGCTCCCCGG - Intronic
1076833751 10:133009698-133009720 GCCGGGAAGTCCCTGCTCAGCGG + Intergenic
1080867209 11:36205900-36205922 GCCTGGAAGTTCCTGCTCCCTGG + Intronic
1083716682 11:64581484-64581506 GCCGGCCATCGCCTGCTCCCAGG + Intergenic
1085763869 11:79265176-79265198 GCATGAAACTGCATGCTCCCTGG + Intronic
1089499495 11:118924050-118924072 GCCCGGAAGTGGCTGCTCCCTGG + Intronic
1091444565 12:536131-536153 GAGGCACAGTGCCTGCTCCCAGG - Intronic
1096355626 12:50938389-50938411 GCTTGGAAGTGCCTGCTCCCTGG - Intergenic
1098893149 12:76030519-76030541 GCCTGAAAGGGGCAGCTCCCGGG - Exonic
1101902602 12:108802209-108802231 GCCTGTAATTGCCTGCACCCTGG - Intronic
1102408038 12:112691115-112691137 GCAGGAAAGTGGCTGAACCCGGG - Intronic
1103309086 12:119989919-119989941 GCCGGACAGCGCCTGCTGCATGG + Exonic
1104736589 12:131139124-131139146 GCAGTGAAGGGCCTGCTCCCAGG - Intronic
1105942324 13:25159782-25159804 GCAGGAAATTGCTTGATCCCAGG + Intergenic
1112372236 13:98804128-98804150 CCAGGAAAGGGCCTGCTCCCCGG - Intronic
1115484879 14:33901109-33901131 GCTTAGAAGTGCCTGCTCCCAGG + Intergenic
1116436276 14:44897792-44897814 GCCGGAACGTGGGGGCTCCCCGG + Intronic
1119374248 14:74176253-74176275 GCCGGAAATTGCTTGAACCCAGG - Intronic
1121281368 14:92701399-92701421 GCCGGAAATTGCTTGAACCCGGG - Intergenic
1122118649 14:99540402-99540424 CCCGGGAAGGGCCGGCTCCCCGG + Intronic
1122619307 14:103045467-103045489 GCTGGACAGCGCCTGCTCCTCGG - Intronic
1122619313 14:103045493-103045515 GCTGGACAGCGCCTGCTCCTCGG - Intronic
1122623909 14:103074571-103074593 CCTGGAGAGTGCCTGCTCACAGG + Intergenic
1122807365 14:104266708-104266730 GCTGGGAAGGGCCTGCTCTCTGG + Intergenic
1122902298 14:104786920-104786942 GCGGGGAGGTGGCTGCTCCCTGG - Intronic
1123067155 14:105624445-105624467 GCCGGCAAGCCCCCGCTCCCCGG - Intergenic
1123076135 14:105668214-105668236 GCCGGCAAGCCCCCGCTCCCCGG - Intergenic
1123096473 14:105769206-105769228 GCCGGCAAGCCCCCGCTCCCCGG - Intergenic
1127418264 15:58778903-58778925 GCCGGAAACTGCATGAACCCAGG - Intronic
1128982472 15:72197594-72197616 GCCGGGAAGTGCCTGCCCCGTGG + Intronic
1129169599 15:73799540-73799562 GCAGGCAAGTCCCTCCTCCCTGG - Intergenic
1133301461 16:4785267-4785289 GCCGGAAATTGCTTGAACCCAGG + Intronic
1133757911 16:8776452-8776474 GCCGGGAAGGCCCTGCTCACAGG + Exonic
1136098832 16:27978334-27978356 GCCGGACAGGGTGTGCTCCCTGG + Intronic
1136247749 16:28985179-28985201 TGTGGAAAGTCCCTGCTCCCAGG - Intronic
1137478750 16:48833561-48833583 GCTGGAAAATGTCTTCTCCCTGG + Intergenic
1142883325 17:2897501-2897523 GCCAGAAATTGCTTGATCCCAGG - Intronic
1145912082 17:28548738-28548760 GCCGCAAAGCCCCTGCTGCCAGG + Intronic
1149570028 17:57665765-57665787 CCAGGAAAGTGCCTGGACCCAGG - Intronic
1151929603 17:77223864-77223886 GCCGGAAAGCGGCTCCTCCCTGG + Intergenic
1151954201 17:77372666-77372688 CCCGGACAGTGCCTTCTCCAGGG + Intronic
1153416466 18:4851049-4851071 GCCAAAAATTTCCTGCTCCCTGG - Intergenic
1154213930 18:12401669-12401691 GCCGGAAAGGGCCTCCTTTCTGG - Intergenic
1155653994 18:28175705-28175727 GCTCGGAAGTGCCTGCTCCGGGG - Intronic
1156034157 18:32748305-32748327 GCCGGAAATTGCTTGAACCCGGG - Intronic
1159203891 18:65225270-65225292 CCTGGTAAGGGCCTGCTCCCTGG - Intergenic
1159558224 18:69967207-69967229 CCCGGAAACTCCCTGCACCCGGG + Intergenic
1161125211 19:2552208-2552230 GCCGGAAATTGCTTGAACCCAGG + Intronic
1162348597 19:10135789-10135811 GCGGGAGTGTGCCCGCTCCCAGG - Exonic
1167716008 19:51143272-51143294 GCCAGGAAGTGCTTCCTCCCTGG - Intronic
1167768734 19:51500821-51500843 GCCAGGAAGTGCTTCCTCCCTGG + Intronic
1168388485 19:55986628-55986650 GCAGAAAAGTGCCTGTTCCCTGG + Intronic
1168411983 19:56146117-56146139 GCTGCAAAGTGTCTGCTCCCAGG + Intronic
932567870 2:72920850-72920872 CCCGGAAAGTTCCTGATCTCGGG - Intronic
936460552 2:112711198-112711220 GCAGCACAGTGCCTGCTCCAGGG + Intergenic
936475660 2:112837615-112837637 CCAGCAAAGTGCCTGCTCCAGGG + Intergenic
937227118 2:120376286-120376308 GCCAGAAAGTCCCTCGTCCCTGG - Intergenic
939315046 2:140537539-140537561 GCAAGAAAGAGTCTGCTCCCGGG - Intronic
941938412 2:171006145-171006167 ACCAGTAAGTGCCTGCCCCCTGG + Exonic
943783162 2:191846882-191846904 GCCGAAAAGTTCCAGCACCCTGG - Exonic
947178850 2:227394537-227394559 GATGGACAGAGCCTGCTCCCTGG - Intergenic
948057987 2:235023452-235023474 GCAGGAAATTGCCTGAACCCGGG + Intronic
948565706 2:238884802-238884824 GCCGGAAAGTGCCTGCTCCCTGG + Intronic
1178283546 21:31305882-31305904 GCCAGAAGGTGTCTGCTCACGGG + Intronic
1178445782 21:32640387-32640409 GCAGGAAAGTGCCAGAACCCAGG - Intronic
1180721755 22:17914571-17914593 GCAGGCAAGTTCCTGCTCTCGGG - Intronic
1182589570 22:31368515-31368537 GCCAGAACATGCCTGCTCTCTGG + Intergenic
1183474423 22:38028063-38028085 CACCGAAAGTCCCTGCTCCCTGG + Intronic
1183998534 22:41654752-41654774 GCCGGACAGTGCCTCCTCCCTGG - Intronic
1184152816 22:42648530-42648552 GCCGGAAGGAGCCTGCTCCATGG - Intronic
1184358924 22:44002077-44002099 GGGTGAAAGTGCCTGCACCCTGG - Intronic
1184441848 22:44521903-44521925 AGCTGAAAGTGCCAGCTCCCTGG + Intergenic
950207428 3:11091814-11091836 GCTGGACAGGACCTGCTCCCAGG + Intergenic
950426173 3:12925873-12925895 GCGGGGCAGGGCCTGCTCCCAGG - Intronic
954341336 3:49956426-49956448 GCAGGAAAATGCCTGAACCCGGG - Intronic
959275779 3:104276208-104276230 GCCCTAAAATGCATGCTCCCTGG - Intergenic
961646283 3:128394387-128394409 TCTGGAAAATGACTGCTCCCCGG + Intronic
968609342 4:1550039-1550061 GCCGGAGAGTGGCTGCTCCTAGG - Intergenic
968974180 4:3812436-3812458 TCCCTGAAGTGCCTGCTCCCAGG - Intergenic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
985123679 4:186669186-186669208 GCCAGAAGGTGCCTGCGCCCAGG + Intronic
985260623 4:188111812-188111834 GCCGGAAATTGCTTGAACCCAGG + Intergenic
985731312 5:1550541-1550563 GACGGAAACAGCCTGATCCCAGG - Intergenic
986432561 5:7695785-7695807 GCTGGCAAGTGACTGCTCCCCGG + Exonic
990003533 5:50921791-50921813 GCCGGAGATTGGCTGCTCCCAGG + Intergenic
990278929 5:54229344-54229366 GACTGAATGTGCCTGCCCCCTGG + Intronic
990953708 5:61323190-61323212 GCCCAAGAGTTCCTGCTCCCTGG - Intergenic
991692057 5:69234929-69234951 GCCGAAAAGGGCGAGCTCCCAGG - Exonic
1000343654 5:160296568-160296590 GGAGGAGAGTGCCAGCTCCCTGG - Intronic
1002199764 5:177521147-177521169 GCCGGAAAAGGCCTGACCCCAGG + Intronic
1002434917 5:179225377-179225399 GCAGGGAAGTGCATGGTCCCTGG + Intronic
1003556169 6:7141837-7141859 GCCAGAAAGGCCCTGCTTCCTGG - Intronic
1004359819 6:14961217-14961239 GGCAGTAAGTGCCTTCTCCCAGG - Intergenic
1006358915 6:33576783-33576805 GCTGGGGATTGCCTGCTCCCAGG - Intronic
1012354575 6:98297852-98297874 GCTGGAAAGTGCCTGCATACTGG + Intergenic
1013354538 6:109335440-109335462 GCCTGAATGGGCCTCCTCCCTGG + Intergenic
1016463048 6:144298356-144298378 GCTGGAAACTACCTGCTTCCTGG - Intronic
1017823514 6:158065142-158065164 GCAGGAAAGCGCAGGCTCCCGGG - Intronic
1019322647 7:422653-422675 GCCGCAGAGTGCCTGGTTCCTGG - Intergenic
1023367243 7:39475932-39475954 CCCAGAAAGTTCCTACTCCCTGG + Intronic
1024062242 7:45707981-45708003 GAGGGAAATTGCCTACTCCCTGG + Intronic
1026874557 7:73871855-73871877 GCCCCAAAGAGCCTGTTCCCAGG + Intergenic
1027193302 7:76010634-76010656 GTGGGAAAGTGCCTGCTCTCTGG - Intronic
1029361021 7:100088864-100088886 CCCGGGAACTGCCTGCTCCCCGG + Intergenic
1029418107 7:100456265-100456287 GCTGGAAACTGCCAGCTCCCAGG - Intergenic
1029528750 7:101111531-101111553 GCAGGAATGAGCCTTCTCCCAGG - Intergenic
1029587581 7:101485290-101485312 GCTGGAACCTGACTGCTCCCAGG - Intronic
1029972907 7:104806809-104806831 GAGGGAAAGTGCCTGATCTCAGG - Intronic
1031495488 7:122442366-122442388 TCAGCAAAGTGCCTCCTCCCAGG + Intronic
1034258885 7:149741808-149741830 GACGTACAGTGGCTGCTCCCGGG - Intergenic
1034501774 7:151455285-151455307 ACCTGAAAGTGCAGGCTCCCAGG - Intergenic
1035488374 7:159249806-159249828 GCTGGAAAGTCCATGCTTCCTGG - Intergenic
1039411645 8:37359994-37360016 GTCGGAAAGTGCCAACTCCTAGG - Intergenic
1042495812 8:69453571-69453593 GCCTGAAAGTGAAGGCTCCCAGG + Intergenic
1045569017 8:103350741-103350763 GCAGGCAACTGCCTTCTCCCTGG + Intergenic
1046654028 8:116874127-116874149 GGCGGAAGGTTGCTGCTCCCGGG + Intronic
1053408975 9:37903702-37903724 GCCGGGAGCTGCCTGCGCCCGGG - Exonic
1056085905 9:83149142-83149164 CCAGGAAAGAGCCTGCTCCCAGG + Intergenic
1057185175 9:93053360-93053382 GCCGCCAAGTGCCTGGTCACTGG - Intergenic
1058691471 9:107524024-107524046 GCTGGAAATTGCCTGAACCCGGG + Intergenic
1060764536 9:126283817-126283839 CCCGGAAAGCCCCTGCTCTCTGG - Intergenic
1061432850 9:130542344-130542366 CCCAGAAAGGGCCTGGTCCCAGG + Intergenic
1061622609 9:131821426-131821448 GCCCCAAAGTGCCTGCTCGTAGG - Intergenic
1061878307 9:133555927-133555949 TCAGGAAAGTGCCTCCTACCTGG - Exonic
1062159220 9:135070518-135070540 GCGGGAAAGCGGCTGCTTCCTGG + Intergenic
1062466493 9:136683879-136683901 GCCGGCCAGTGCATGGTCCCGGG - Intronic
1187666981 X:21624600-21624622 GCCGGAAATTGCTTGAACCCGGG - Intronic
1189195920 X:39152337-39152359 GTCAGAAAAGGCCTGCTCCCCGG - Intergenic
1199868481 X:151875458-151875480 GCCAGAGAGTGCCTGCAGCCAGG - Intergenic