ID: 948568253

View in Genome Browser
Species Human (GRCh38)
Location 2:238900028-238900050
Sequence TGGAATAGTTTAATATAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 965
Summary {0: 1, 1: 0, 2: 2, 3: 66, 4: 896}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948568251_948568253 -6 Left 948568251 2:238900011-238900033 CCTTCATCTTTAAATTCTGGAAT 0: 1
1: 0
2: 2
3: 41
4: 455
Right 948568253 2:238900028-238900050 TGGAATAGTTTAATATAGATGGG 0: 1
1: 0
2: 2
3: 66
4: 896

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948568253 Original CRISPR TGGAATAGTTTAATATAGAT GGG Intronic
901256443 1:7832050-7832072 TTAAATATTTTAATATATATGGG + Intronic
902322127 1:15675476-15675498 TGGAATGGTTGGATATAGGTAGG - Intergenic
902997980 1:20242501-20242523 TGGAAGAGTTGAGAATAGATTGG - Intergenic
905961400 1:42045491-42045513 TAGAATAGCTTAAATTAGATAGG - Intergenic
906839244 1:49118750-49118772 TGGAATAGTTTCAGATGGAATGG + Intronic
906910048 1:49938434-49938456 TGGAATAGTTTCAGAAAGAATGG - Intronic
907065397 1:51477007-51477029 TGGAATAGTTTCAGAAAGAATGG + Intronic
907561395 1:55392444-55392466 TGGAATAGTTTCAATAAGATTGG + Intergenic
907741805 1:57173507-57173529 TGGAATATTTGCATATACATAGG - Intronic
908058989 1:60325906-60325928 TGGAATAGTTTCAGAAGGATTGG + Intergenic
908222719 1:62024252-62024274 TGGAATAGTTTCAGTAAGATTGG + Intronic
908712733 1:67035250-67035272 TGGAATAGTTTCAGTAAGATTGG + Intronic
908883135 1:68756136-68756158 TGTAATTCTTTAATAGAGATTGG - Intergenic
908889807 1:68833034-68833056 TGGAAAAGTTTGAGAGAGATTGG - Intergenic
908908358 1:69042522-69042544 TGGAATAGTTTGAGAAGGATTGG - Intergenic
909414529 1:75390246-75390268 TGGAATAGTTTCAGTAAGATTGG - Intronic
909566030 1:77054515-77054537 TGAAAGAGTTTGATTTAGATTGG - Intronic
909869432 1:80720818-80720840 TGGAATAGTTTAAGAAAAAATGG + Intergenic
909985541 1:82156747-82156769 AGTAATAATTTAATATATATTGG - Intergenic
910261889 1:85301009-85301031 TAGCAAATTTTAATATAGATAGG - Intergenic
910360747 1:86411904-86411926 TGCAACAGGTCAATATAGATTGG - Intergenic
910612277 1:89157796-89157818 TGGAATAGTTTCAGAAAGAATGG - Intronic
911487518 1:98520633-98520655 GGGAATAGTTTAAGTAAGATTGG - Intergenic
911818535 1:102386078-102386100 TGGAATAGTTTCAGAAAGAATGG - Intergenic
912097779 1:106166720-106166742 TGGAATAGTTTCAGAAGGATTGG - Intergenic
912108723 1:106313742-106313764 TGGAATAGTTTCAGAAGGATTGG + Intergenic
912110305 1:106332966-106332988 TGGAATAGTTTCAGAAGGATTGG - Intergenic
913434711 1:118835010-118835032 TGGAATAGTTTCAGAAAGAATGG - Intergenic
913663419 1:121025500-121025522 TGGAATAGTTTTAGTAAGATTGG - Intergenic
914014810 1:143808768-143808790 TGGAATAGTTTTAGTAAGATTGG - Intergenic
914163011 1:145152439-145152461 TGGAATAGTTTTAGTAAGATTGG + Intergenic
914653431 1:149717325-149717347 TGGAATAGTTTTAGTAAGATTGG - Intergenic
914852114 1:151322557-151322579 TGGACTAGATAAATATGGATTGG + Intronic
915258380 1:154653924-154653946 TGGAAAAGTCTAATAAGGATTGG + Intergenic
916006101 1:160662312-160662334 TGGAATAGTTTTAGTAAGATTGG + Intergenic
916140890 1:161696741-161696763 TGGAATAGTTTCAGAAAGAATGG - Intergenic
916393040 1:164353770-164353792 TGGAAGAGTTTGAGAAAGATTGG - Intergenic
916625233 1:166548678-166548700 TGGAATAGTTTTAGATGGAATGG + Intergenic
916835379 1:168539292-168539314 TGGAATAGTTTCAGAAAGAGTGG + Intergenic
916836204 1:168548107-168548129 TGGAATAGTTTCAGAAAGAATGG - Intergenic
917578917 1:176354180-176354202 TGGAAGAGTTTAAGAAGGATTGG + Intergenic
917970475 1:180202904-180202926 TGTAATATTTTAGTAGAGATGGG - Exonic
918537491 1:185589975-185589997 TGGAATAGTTTCAGAAAGAATGG - Intergenic
918950473 1:191129709-191129731 TGGAATAGTTTCAGTAAGATTGG - Intergenic
918989662 1:191682421-191682443 TGGAATAGTTTCAGAAGGATTGG - Intergenic
919146458 1:193641971-193641993 TGGAATAGTTTCAGAAAGAATGG + Intergenic
919599321 1:199603104-199603126 TGGAATAGTTTCAGAAAGAATGG - Intergenic
920809612 1:209270382-209270404 TTGAATTTTTTAATAGAGATGGG + Intergenic
921407454 1:214796652-214796674 TGGAATAGTTTCAGTAAGATTGG + Intergenic
921529458 1:216263214-216263236 TGGAATAGTTTAAGAAAAAATGG - Intronic
921794613 1:219327626-219327648 AGGAATAGTGTGATATAGTTTGG + Intergenic
921843166 1:219850400-219850422 TGGAATAGTTTGATTAAGATTGG - Intronic
922125828 1:222722274-222722296 TGGTTGTGTTTAATATAGATGGG - Intronic
922379702 1:225010648-225010670 TGGAATAGTTTCAGACAGAATGG + Intronic
923174439 1:231450198-231450220 TGGAATAGTTTCAGTAAGATTGG - Intergenic
923204804 1:231748784-231748806 TGGAATAGTTTAAGAAGAATTGG + Intronic
923352175 1:233119131-233119153 TGGAATAATTAGATATAAATAGG + Intronic
923563114 1:235056685-235056707 TACAATATTTTAATAGAGATGGG - Intergenic
923875598 1:238043365-238043387 TGGAATAGTGTCAAAAAGATTGG - Intergenic
923974513 1:239246404-239246426 TAAAAAAGTTTAATAAAGATAGG + Intergenic
924863949 1:247957496-247957518 TGGAATAGTTTCAGAAAGAATGG + Intronic
1063593776 10:7414219-7414241 TGGAATTCTTTAACATAAATGGG + Intergenic
1064182705 10:13133036-13133058 TGTAAAAGTATAAAATAGATGGG - Intronic
1064376056 10:14797057-14797079 TGGAATAATCTAAAATAGAGGGG - Intergenic
1064921880 10:20528266-20528288 TGGAATAGTTTCAGAAGGATTGG + Intergenic
1065075681 10:22076876-22076898 TGGAATAGTTTCAAAAAGAATGG + Intergenic
1065237545 10:23668970-23668992 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1065718201 10:28594829-28594851 GGGAATATTGTAATTTAGATTGG + Intronic
1065752538 10:28900334-28900356 TGAAATAGGTTGATATAGATAGG + Intergenic
1065977714 10:30857856-30857878 TGAAACAGTTTAATAAAGCTGGG - Intronic
1066051497 10:31640362-31640384 TGGAATAGTTTCATAAAGAATGG + Intergenic
1066060148 10:31716242-31716264 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1066151703 10:32628066-32628088 TAGAACAGTTTAAGAAAGATTGG + Intronic
1066774747 10:38876383-38876405 TGGAATGGATTCATATAGAATGG + Intergenic
1066774794 10:38876778-38876800 TGGAATGGATTCATATAGAATGG + Intergenic
1067020612 10:42793662-42793684 TGGAAAAGTTTAATGGAGATGGG + Intronic
1067230817 10:44408259-44408281 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1067500314 10:46797839-46797861 TGGACAAGTTTAATGGAGATGGG + Intergenic
1067579794 10:47435863-47435885 TGGAATAGTTTCAGTAAGATTGG + Intergenic
1067594314 10:47542474-47542496 TGGACAAGTTTAATGGAGATGGG - Intronic
1067641423 10:48050589-48050611 TGGACAAGTTTAATGGAGATGGG - Intergenic
1067672610 10:48338034-48338056 TGGAATAGTTTCAGTAAGATTGG - Intronic
1067998405 10:51302604-51302626 AGGAATAGTTTACTAAATATGGG + Intronic
1068423634 10:56827200-56827222 TGGAATAGTTTCAGTAAGATTGG - Intergenic
1068481057 10:57588865-57588887 TGGAATAGTGTCAAAAAGATTGG - Intergenic
1068642067 10:59420590-59420612 TGGAAGAGTTTGAGAAAGATTGG - Intergenic
1068956844 10:62826084-62826106 TGGAATAGATAAATATATAAAGG - Intronic
1069353964 10:67562077-67562099 TGGAATAGTTTCAGAAAGAATGG - Intronic
1069516018 10:69077924-69077946 TTGTATATTTTAATAGAGATGGG + Intergenic
1070138677 10:73719466-73719488 TGGAAAAGTTTAATGGAGATGGG - Intergenic
1070666315 10:78347528-78347550 TGGAAGAGTTTATTAAAAATTGG + Intergenic
1071059370 10:81551700-81551722 TGGAATAGTTTAAGAAGGAATGG - Intergenic
1071108995 10:82132626-82132648 TGGAATAGTTTAAGTAGGATTGG + Intronic
1071381918 10:85074566-85074588 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1071422904 10:85519140-85519162 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1071425145 10:85542005-85542027 TTATATAGTTTAATATAAATGGG - Intergenic
1071737846 10:88321893-88321915 TGGAATCGTTTCATTGAGATTGG - Intronic
1072018154 10:91370585-91370607 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1072305528 10:94102908-94102930 AGGCATAGTTTAAAATAGTTTGG + Intronic
1072369554 10:94751042-94751064 TGGAATAGTTTAAGTAGGATTGG + Intronic
1072869529 10:99102570-99102592 TGGAATAGTTTCAGAAAGAATGG - Intronic
1072886774 10:99283971-99283993 TGGAATAGTTTTAGAAGGATTGG - Intergenic
1073581608 10:104672029-104672051 TGGAAAAGTTTAAGAAGGATTGG + Intronic
1074016424 10:109539148-109539170 TGGAATAGTTTCAAAAGGATTGG + Intergenic
1074037062 10:109750545-109750567 TGGAATAGTTTCAGTTGGATTGG + Intergenic
1074143052 10:110693313-110693335 TGGAAGAGTTTGAGAAAGATTGG + Intronic
1074643837 10:115421133-115421155 TGGAATAGTTTGATAGTAATTGG - Intronic
1075157832 10:119994002-119994024 TGGAATAGTTTTAGCAAGATTGG + Intergenic
1075941254 10:126392140-126392162 TGACATAGATGAATATAGATGGG - Intergenic
1077857113 11:6138970-6138992 TGGAAAAGTTTGAGAAAGATTGG - Intergenic
1078305143 11:10176779-10176801 TGGAATAGTTTCAGAGGGATTGG - Intronic
1078681203 11:13478363-13478385 TTGAATAGTTTAAGTTAAATGGG - Intergenic
1079418389 11:20262076-20262098 TTAAATAATTTAATATAAATAGG + Intergenic
1079482878 11:20900554-20900576 TGGAAGAGTTTATTTAAGATTGG - Intronic
1079523725 11:21359552-21359574 TGGAATAGTTTCAGTGAGATTGG + Intronic
1079609232 11:22410820-22410842 TGGAAGAGTTTAAGAAAGATTGG - Intergenic
1079713168 11:23711492-23711514 TGGAACAGTTCAATAAAGCTTGG + Intergenic
1079741790 11:24071556-24071578 TGGAATAGTTTCATAAGGAATGG - Intergenic
1079771694 11:24469669-24469691 TTGAATAGTTTGAAAAAGATTGG + Intergenic
1079814294 11:25036019-25036041 TGGAATAGTTTCAGTAAGATTGG + Intronic
1079890348 11:26044501-26044523 TTTAATACTTTAATTTAGATTGG - Intergenic
1080122283 11:28691710-28691732 TTGTATTTTTTAATATAGATGGG - Intergenic
1080488304 11:32734359-32734381 TGGAATAGTTTCAGAAAGAATGG - Intronic
1080491171 11:32765895-32765917 TGGAATAGTTTCAGAAAGAATGG - Intronic
1080672243 11:34391606-34391628 TGGAATAGTGTCAAAAAGATTGG + Intergenic
1081077135 11:38691697-38691719 TAAACTAGTTTAATATAGTTCGG + Intergenic
1081093848 11:38907221-38907243 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1081380160 11:42405101-42405123 TACAAAAGTTTAAAATAGATAGG + Intergenic
1081404901 11:42686561-42686583 TGAAAAAGTTTAATAAAGATTGG - Intergenic
1081454630 11:43209260-43209282 TGGAATAGTTTCAGAAAGAAGGG + Intergenic
1082120540 11:48375004-48375026 TGGAATAGTTTCAGTAAGATTGG + Intergenic
1082240802 11:49868482-49868504 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1082253764 11:50010214-50010236 TGGAATAGTTTCAGTAAGATTGG - Intergenic
1082860533 11:57851430-57851452 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1082903289 11:58279878-58279900 TGGAATAGTTTAAGAAGGAATGG + Intergenic
1083009595 11:59384198-59384220 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1083095917 11:60251269-60251291 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1084552575 11:69854964-69854986 TGGAAAAATGTAATATATATAGG + Intergenic
1085434257 11:76485136-76485158 TGGAATAGTTTCATAAGGAATGG - Intronic
1085995891 11:81913524-81913546 TGGAATATTTTCATATACACTGG + Intergenic
1086015708 11:82164756-82164778 TGGAATAGTTTCAGTAAGATAGG - Intergenic
1086294699 11:85351962-85351984 TGGAATAGTTTCAGAAAGAATGG + Intronic
1086470707 11:87106612-87106634 TGGAAGAGTTTGAGAAAGATTGG + Intronic
1086889740 11:92243843-92243865 TAAAATATTTTAATAAAGATTGG - Intergenic
1087668139 11:101073919-101073941 TGGAATAGTTTTAGAAAGAATGG - Intronic
1087742059 11:101899198-101899220 TGGAATAGTTTCAGAAAGAATGG + Intronic
1087918440 11:103837192-103837214 TTGAATAGTCTAATATGGTTAGG - Intergenic
1088236050 11:107724455-107724477 AGGGAAACTTTAATATAGATTGG - Intergenic
1088943855 11:114489297-114489319 TGGAATAGTTTCAGATGGAATGG - Intergenic
1090688507 11:129152323-129152345 TGGAATAGTTTCACTAAGATTGG - Intronic
1090933030 11:131316111-131316133 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1091424288 12:373145-373167 TGGAATAGTTTCAGAAAGAATGG + Intronic
1091707184 12:2703077-2703099 TGGAATAGTTTCAGAAGGATTGG - Intergenic
1092320478 12:7468660-7468682 TGGAATAGTTTGAGTAAGATTGG - Intronic
1093206368 12:16256242-16256264 TGAAATAGTTTCATAAAGACAGG - Intronic
1093468671 12:19477834-19477856 TGGAATAGTTACATTAAGATTGG + Intronic
1093541763 12:20295790-20295812 TGGAATAGTTTAAATAAGATTGG + Intergenic
1093583578 12:20810394-20810416 TGGAATAGTTTTAAATACTTTGG + Intergenic
1094258881 12:28468531-28468553 TGGAATAGTTTGAGAAGGATTGG - Intronic
1094447016 12:30542342-30542364 TGGAATAGTTTCAGTAAGATTGG + Intergenic
1094755741 12:33466310-33466332 TGGAATAGTTTCAGATAGAATGG - Intergenic
1095067039 12:37790497-37790519 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1095191516 12:39263312-39263334 TGGAATAGTTTCAGATGGAATGG - Intergenic
1095217435 12:39566182-39566204 TGGAATAGTTTCAGAAAGAATGG + Intronic
1095784754 12:46097751-46097773 TGGAATAGTTTCAGTAAGATTGG - Intergenic
1096036684 12:48477835-48477857 TGGAATAGTTTCAGAAGGATTGG - Intergenic
1097595525 12:61624556-61624578 TGAAATAGTTTCACATGGATTGG - Intergenic
1097608745 12:61789804-61789826 TGGAATAGTTTAAGATGAGTTGG - Intronic
1097916711 12:65028373-65028395 TAGAATAGTTTAATCTAATTCGG + Intergenic
1098015167 12:66096983-66097005 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1098404812 12:70113191-70113213 TGTAATAGTTTCATAAGGATTGG - Intergenic
1098538438 12:71622385-71622407 GGGAAGAGATTATTATAGATTGG - Intronic
1098667146 12:73178893-73178915 TGGAATAGTTTGAGAAGGATTGG + Intergenic
1098820545 12:75222192-75222214 TAGAAGGGATTAATATAGATAGG + Intergenic
1098913015 12:76229498-76229520 TGGAAAAGTTTGATAAAGAGTGG + Intergenic
1099053135 12:77805719-77805741 TGGAATAGTTTCATAAGGAATGG + Intergenic
1099358024 12:81662639-81662661 TGGAATAGTTTCAGATGGAATGG - Intronic
1099409966 12:82313034-82313056 TGGAATAGTTTCAGATGGAATGG + Intronic
1099486847 12:83239438-83239460 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1099900583 12:88706382-88706404 TGGAATAGTTTCAACAAGATTGG + Intergenic
1100139443 12:91599212-91599234 TGGAGTAGTTTAGTATATTTAGG - Intergenic
1100264532 12:92962714-92962736 TAAAAAATTTTAATATAGATGGG + Intergenic
1100285528 12:93162748-93162770 TGGAATAGTTTATATAAGATTGG + Intergenic
1100652058 12:96601508-96601530 TGGAATAGTTTCAGAAAGAATGG + Intronic
1100894313 12:99162454-99162476 TGGGGTTGTTTAATATATATTGG + Intronic
1101174929 12:102140036-102140058 TGGAATAGTTTCAGAAAGAATGG + Intronic
1101271456 12:103150017-103150039 TGGAAAATTTTAATATGGGTGGG - Intergenic
1101309942 12:103568207-103568229 TGGAATAGTTTCAGTAAGATTGG - Intergenic
1103179192 12:118893693-118893715 TGGAATAGTTTCAGTAAGATTGG - Intergenic
1104102797 12:125630190-125630212 TGGAATAGTTTGAATAAGATTGG + Intronic
1104158303 12:126154210-126154232 TTGAATTGTTTATTATAGAGTGG - Intergenic
1105672358 13:22633610-22633632 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1106072817 13:26429628-26429650 TGGAAGAGTTTGAAACAGATTGG - Intergenic
1106873974 13:34052139-34052161 TGGAATAGTTTCAGAAGGATTGG + Intergenic
1108113818 13:47106202-47106224 TGGAATAGTTTAAGAAGGAATGG - Intergenic
1108143760 13:47454635-47454657 TGGAATAGTTTCAGTAAGATTGG + Intergenic
1108624679 13:52216157-52216179 TGGAATAGTTTCAAAAGGATTGG - Intergenic
1108849988 13:54716610-54716632 TGGAATAGTTTCAGAAGGATAGG + Intergenic
1108882774 13:55141671-55141693 TGGAATAGTTTTAGTAAGATTGG + Intergenic
1109014875 13:56996451-56996473 TGGAATAGTTTCAGAAGGATTGG - Intergenic
1109318362 13:60778986-60779008 TGGAATAGTTTATTTTGGAATGG + Intergenic
1109329014 13:60904518-60904540 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1109591084 13:64483501-64483523 GGGAATAGTTTATAATAAATAGG + Intergenic
1109747982 13:66651600-66651622 TGGAATAGTTTTAGTCAGATTGG - Intronic
1109844234 13:67963822-67963844 TGCAATATTTTAAAATATATTGG - Intergenic
1109917730 13:69014171-69014193 TGGTAGAGTTTAATATAAAAAGG - Intergenic
1110149083 13:72228326-72228348 TGGAATAGTTTCAGAAGGATTGG + Intergenic
1110152111 13:72268032-72268054 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1110253854 13:73410014-73410036 TGGAATAGTTTAATGTAAAGGGG + Intergenic
1110926483 13:81160610-81160632 TGGAATAGTTTAAGAATGATCGG - Intergenic
1111335953 13:86823391-86823413 TGGAAGAGTTTGAGACAGATTGG - Intergenic
1111350831 13:87028769-87028791 TGGAATAGTAGAATGTGGATGGG + Intergenic
1112087683 13:96048920-96048942 TGGAATAGTTTAAGAAAGAATGG - Intronic
1112713365 13:102156097-102156119 TGGAATAGTTTCAGAAAGAATGG - Intronic
1112821474 13:103341853-103341875 TGGAATAGTTTGATAAGAATTGG + Intergenic
1112952029 13:105010725-105010747 AAGAATAGATTAATAAAGATGGG - Intergenic
1113131336 13:107040609-107040631 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1113276617 13:108737689-108737711 TGGAATAGTTTCAGACAGAATGG + Intronic
1113330355 13:109320598-109320620 TGGAATAGTATCAAAAAGATTGG - Intergenic
1113406920 13:110049869-110049891 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1113521313 13:110943449-110943471 TGGAATGGTTTAGTAGAAATAGG + Intergenic
1113974605 13:114217463-114217485 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1114687738 14:24549766-24549788 AGGAATAGTTTGATTAAGATTGG + Intergenic
1114797201 14:25729634-25729656 TGGAATAGTTTCAGAAGGATTGG + Intergenic
1115082378 14:29471530-29471552 TGGAATAGTTCATAAAAGATGGG + Intergenic
1115211766 14:30973560-30973582 TGGAAAAGTTTGAGAAAGATTGG - Intronic
1115949026 14:38698808-38698830 TGGAATAGTTTGAGTTAGACTGG - Intergenic
1116059447 14:39902295-39902317 TGAAATAGTTTAAGTAAGATTGG + Intergenic
1116074107 14:40088129-40088151 TGGAATAGTTTAAAAAGGAATGG + Intergenic
1116330771 14:43595103-43595125 TGGAATAGTTTCCTTTGGATAGG + Intergenic
1116412749 14:44644315-44644337 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1116506285 14:45686108-45686130 TGGAATAGTTTGAGTAAGATTGG + Intergenic
1116697048 14:48190536-48190558 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1118064236 14:62173381-62173403 TGGGAAAGTTTAATATAATTTGG + Intergenic
1118077582 14:62317575-62317597 TTGAATATGTTAATATACATGGG + Intergenic
1118080521 14:62353830-62353852 TGGAAGAGTTTAAGAAGGATTGG + Intergenic
1118524981 14:66630031-66630053 TGACATAGTTAAATATTGATGGG + Intronic
1118798122 14:69163435-69163457 TGGAATAGTTTAAGTAGGATTGG - Intergenic
1119186240 14:72644637-72644659 TGCACTACTTTAATATTGATGGG - Intronic
1120054208 14:79903129-79903151 TGGAAAAGTTTAAGAAGGATTGG + Intergenic
1120290365 14:82562020-82562042 TGAAATAGTTACATATATATAGG + Intergenic
1120672043 14:87373735-87373757 TGGAAAAATTAAATATGGATTGG - Intergenic
1120685807 14:87535650-87535672 AGGAATAGTTTAATATAAATAGG - Intergenic
1121470406 14:94149209-94149231 TGGAATAGTTTCAGAAGGATTGG + Intronic
1122912581 14:104839500-104839522 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1202869296 14_GL000225v1_random:145390-145412 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1123506783 15:20949397-20949419 TGGAACAGTTTAAAATGGAGGGG + Intergenic
1123860123 15:24457515-24457537 TGGAACACTTTAATAAAAATTGG + Intergenic
1123952236 15:25291732-25291754 TGGAAGAGCTTAATAAAGAGTGG - Intergenic
1124074083 15:26426076-26426098 TGGAAGAGTTTGAGAAAGATTGG + Intergenic
1125637040 15:41197795-41197817 TTGTATATTTTAATAGAGATGGG + Intronic
1125837684 15:42767700-42767722 TGGAATAGTTTCAGAAAGAATGG - Intronic
1126239793 15:46428493-46428515 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1126258843 15:46662359-46662381 TGGAATAGTTTGAAAAGGATTGG - Intergenic
1126991539 15:54383134-54383156 TGGAATAGTTTAAGAAAAAGTGG - Intronic
1127105120 15:55605509-55605531 TGGAATAGTTTAAGAAGGAATGG - Intergenic
1128012820 15:64314282-64314304 TGGAAGAGTTTTAGATAGAGGGG + Intronic
1128193581 15:65728297-65728319 TAGAATACTTAAATATAGACTGG - Intronic
1128531936 15:68459343-68459365 AGGAATAATTTAACAGAGATGGG + Intergenic
1130007975 15:80120214-80120236 TAGAATAGTTTGATATATGTGGG + Intronic
1131795953 15:96016872-96016894 TTGAAAAGTTTAACATGGATGGG - Intergenic
1131898194 15:97057163-97057185 AGGTATATTATAATATAGATAGG - Intergenic
1202972369 15_KI270727v1_random:250237-250259 TGGAACAGTTTAAAATGGAGGGG + Intergenic
1135885234 16:26300081-26300103 TGAAATAGTTTAGTATAGACTGG + Intergenic
1136057620 16:27702080-27702102 AGGAATAGTTTAACAGAGTTTGG - Intronic
1136653156 16:31690764-31690786 TGGAATAGTTTCAGAAAGAGTGG - Intergenic
1137008270 16:35298642-35298664 TGGAATTGTGAAATATACATGGG - Intergenic
1137014976 16:35365597-35365619 TGGAATTGTGAAATATACATAGG - Intergenic
1137755291 16:50896706-50896728 TGGAATAATTTGCTGTAGATTGG + Intergenic
1138665229 16:58561329-58561351 TGGAAAATTTTAATATATTTTGG - Intronic
1138899949 16:61256709-61256731 TATAATAGTTTAGGATAGATGGG + Intergenic
1139110309 16:63882270-63882292 TGGAATAAGTTAATAAACATGGG - Intergenic
1139156192 16:64445651-64445673 TGGAATAGCTAAATATCAATAGG - Intergenic
1139173015 16:64653429-64653451 TGGAATAGTTTCAGTAAGATTGG - Intergenic
1140538931 16:75737387-75737409 TGGAATAGTTTCAGAAAGAATGG + Intronic
1143915746 17:10291614-10291636 TGGAACAGCTTGATATAGTTTGG + Intergenic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1144380431 17:14690625-14690647 TGGAAGAGTTTGAGAAAGATTGG + Intergenic
1145332478 17:21884310-21884332 TGGAATGGTTTGAAATGGATTGG + Intergenic
1145335485 17:21908910-21908932 TGGAATGGTCTCATATAGAAGGG + Intergenic
1145926521 17:28651232-28651254 TGGTATTTTTTAATAGAGATGGG + Intronic
1146311182 17:31769614-31769636 TGGACTAGTTTAACAGAGAGTGG - Intergenic
1147355032 17:39888392-39888414 TTAAATAGTTTACTATGGATCGG - Intergenic
1147519494 17:41156512-41156534 TGGAAGAGTTTGATAAGGATTGG + Intergenic
1149240454 17:54642785-54642807 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1153100532 18:1463791-1463813 TAGAATAGTTTGATATTTATGGG + Intergenic
1153113547 18:1625110-1625132 TTTAATATTTTAATATTGATGGG + Intergenic
1153355413 18:4129304-4129326 TGTAATACTTGAATTTAGATTGG - Intronic
1153425371 18:4957300-4957322 TGGAATAGTTTAAGTAGGATTGG - Intergenic
1154101775 18:11481571-11481593 TGGAATAGTGTAAAGTAGTTTGG - Intergenic
1154401277 18:14040142-14040164 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1155418127 18:25623400-25623422 TGGAAGAGTTTCATAAGGATTGG + Intergenic
1155701462 18:28749360-28749382 TGGAATAGTTTCATAAGGAATGG - Intergenic
1155729998 18:29144835-29144857 TGTAACAGAATAATATAGATGGG + Intergenic
1156280362 18:35631141-35631163 TGGAATAGTTTCATAAGGAATGG - Intronic
1156611172 18:38726436-38726458 TGAAGTAGTTTTCTATAGATGGG + Intergenic
1156614085 18:38762758-38762780 TGGAATAGTGTCAAACAGATTGG - Intergenic
1157037051 18:43987619-43987641 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1157381062 18:47217898-47217920 AGGAATAGTTTACTATCTATAGG + Intronic
1158089096 18:53689749-53689771 TGGAATGATTTAATGTATATAGG - Intergenic
1158153775 18:54402285-54402307 TGGAATAGTTTCATAAGGAATGG + Intergenic
1158307552 18:56123308-56123330 AGGGATAGTTTAATTTTGATAGG + Intergenic
1158793805 18:60816430-60816452 TGGAAGAGTTTGAGAGAGATTGG + Intergenic
1158997048 18:62932210-62932232 TGGAATAGTTTCAACAAGATTGG - Intronic
1160134975 18:76264075-76264097 TGGAATATATTAATATATAGTGG + Intergenic
1161157067 19:2737812-2737834 TGGAATAGTTATATATATAAAGG - Intronic
1162560006 19:11411600-11411622 TTGAATATTTGAATATAGACTGG + Intronic
1162628811 19:11909260-11909282 TGGAATAGTTTAAGAAGGAATGG - Intronic
1162692252 19:12442792-12442814 TGGAATAGTTTGAGTAAGATTGG + Intronic
1164018857 19:21278749-21278771 TGGAATAGTTTCAGTAAGATTGG + Intronic
1164273522 19:23695731-23695753 TGAAATAGTTTTATTTAGGTTGG + Intergenic
1164319836 19:24134004-24134026 TGGAATAGTGTCAAAAAGATTGG + Intergenic
1164348323 19:27296765-27296787 TGGAATAGTTTCATAAAGAAAGG - Intergenic
1164450127 19:28354725-28354747 TGGAAAAGTTTGAGAAAGATTGG - Intergenic
1164550064 19:29202963-29202985 TGAAATAGATTATTATAGATCGG - Intergenic
1165260786 19:34615731-34615753 TGGAAGAGTTTAAAATAGATTGG + Intronic
1165298757 19:34953064-34953086 TGGAAAAGTTTAAGAAGGATTGG - Intergenic
1165645924 19:37436909-37436931 TGGAATAGTTTAATTAGGATTGG - Intronic
1165967451 19:39594851-39594873 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1166176619 19:41077067-41077089 TGGAATAGTTTTACAAGGATTGG + Intergenic
1166436574 19:42771640-42771662 TGGAATAGTTTCAGAAAGAATGG + Intronic
1166622038 19:44309842-44309864 AGGAAAATTTTAATAGAGATTGG - Intergenic
925218550 2:2118665-2118687 TGGAATTATTTAATATTGATTGG - Intronic
925334618 2:3085953-3085975 TGGAATAGTTTCAGAAAGAATGG - Intergenic
925669950 2:6300833-6300855 TGAAACAGACTAATATAGATGGG + Intergenic
925760887 2:7183402-7183424 TGGAAGAGTACAATATTGATAGG - Intergenic
927028246 2:19092851-19092873 TGGAATAGTTTCAGATGGAATGG - Intergenic
927525887 2:23740139-23740161 TGGAATAGTTTCAGAAGGATTGG - Intergenic
928250613 2:29674728-29674750 TGGAATAGTTTCATAAGGAATGG + Intronic
928473232 2:31595642-31595664 TGGAATAGTTTCAGTAAGATTGG - Intergenic
928484461 2:31716185-31716207 TGGAATAGTTTGATTAAGTTTGG - Intergenic
928763153 2:34608533-34608555 TGGAATAGTTTAAATAGGATTGG + Intergenic
928766567 2:34653551-34653573 TGGAATAGTTTCAGAAAGAATGG - Intergenic
928851700 2:35755547-35755569 TGGAATAGTTTGATTTGGATTGG + Intergenic
929037046 2:37703764-37703786 TGGAATAGTGTCAAATGGATTGG + Intronic
930264401 2:49183061-49183083 TGGAATAGTTTCAGAAAGAATGG + Intergenic
930268672 2:49230260-49230282 TGGAATAGTTTCAGAAGGATTGG + Intergenic
930477060 2:51894899-51894921 TGGAATAGTTTCAGAAAGAATGG - Intergenic
930875062 2:56205976-56205998 AGGAATGGTTGAATTTAGATAGG + Intronic
930943452 2:57041727-57041749 TGGAACATTTTAAGATAGATGGG + Intergenic
931509076 2:62969610-62969632 TGGATTTGTTTAAGATACATAGG - Intronic
931567906 2:63635309-63635331 TGGAAGAGTTTGAGAAAGATTGG - Intronic
931919607 2:66999386-66999408 TGGAATAGTTTCAGTAAGATTGG - Intergenic
931950826 2:67359687-67359709 TGGAATAGTTTCAGAAAGAATGG - Intergenic
932100265 2:68892846-68892868 TGGAATAGTTTCAAAAGGATGGG + Intergenic
932630982 2:73343158-73343180 TGGAAGAGTTGAACTTAGATGGG + Intergenic
932925743 2:75972021-75972043 TGGAATAGTTTCAGTAAGATTGG - Intergenic
933173134 2:79146108-79146130 TGGAAGAGTTTGAGAAAGATTGG + Intergenic
933397069 2:81746285-81746307 TGGAATAGTTTTAGTAAGATTGG + Intergenic
933920150 2:87037779-87037801 TAAAATAGCTTAATTTAGATTGG + Intergenic
933931474 2:87156007-87156029 TAAAATAGCTTAATTTAGATTGG - Intergenic
934002847 2:87732114-87732136 TAAAATAGCTTAATTTAGATTGG - Intergenic
935000038 2:99004730-99004752 TGGAATAGTTTCAGATGGAATGG - Intronic
935436126 2:103035420-103035442 TGAAAGAATTTAATATAGAATGG + Intergenic
935826084 2:106951338-106951360 TGGAATAGTTTAAAGAAAATTGG + Intergenic
936141154 2:109942304-109942326 TGGAATAGTTTCAGTAAGATTGG - Intergenic
936177842 2:110240249-110240271 TGGAATAGTTTCAGTAAGATTGG - Intergenic
936203539 2:110429182-110429204 TGGAATAGTTTCAGTAAGATTGG + Intronic
936361646 2:111809432-111809454 TAAAATAGCTTAATTTAGATTGG + Intronic
936691697 2:114897289-114897311 TGGAATAGTTTCAGAAAGAATGG + Intronic
936885338 2:117303987-117304009 TGGAATAGTTTGAGTAAGATTGG - Intergenic
936994762 2:118401741-118401763 TGGAATAGTTTGAGAAGGATTGG + Intergenic
937186453 2:120048212-120048234 TGGAATAGTTTCAGAGAGAATGG + Intronic
937522027 2:122723477-122723499 TGGAATAGTTTCAAAAATATTGG - Intergenic
937863052 2:126727878-126727900 TGGAAAAGTTTAAGAAGGATTGG - Intergenic
938963843 2:136368440-136368462 TGGAAGAGTTTAATAAGGGTTGG - Intergenic
939055864 2:137363828-137363850 TGGAATAGTTTCAGAAAGAATGG - Intronic
939348250 2:140996877-140996899 TGGAACAGAATAATATATATAGG - Intronic
939484274 2:142790420-142790442 TGGAATAGTTTACTAGGAATGGG - Intergenic
939947307 2:148425474-148425496 TGGAATAGTTTCAGAAAGAATGG - Intronic
940094525 2:149959255-149959277 TGGAATAGTTATATATATAAAGG - Intergenic
940435527 2:153649018-153649040 TGGAATAGTTTCAGAAAGAATGG + Intergenic
940455964 2:153900742-153900764 TGGAATATTTGCATATAGTTGGG + Intronic
940471088 2:154101259-154101281 TGGAATAGTTTCAGTAAGATTGG + Intronic
940498429 2:154463926-154463948 TGGAATAGTGTAATATTATTTGG + Intergenic
940570378 2:155425191-155425213 TGGAATAGTTTAAGAAGAATTGG + Intergenic
940730062 2:157378323-157378345 TGGAATAGTTTGAGAAAAATTGG - Intergenic
940809481 2:158226393-158226415 TGGAATAGTTTCAGAAAGAATGG - Intronic
941188478 2:162345758-162345780 TGAAATATTTTAAGATACATTGG + Intronic
941387791 2:164874313-164874335 TGGAAGAGTTTAATTTCAATAGG - Intergenic
941694151 2:168533322-168533344 TGGAATAGTTTGGAATAGATTGG + Intronic
941694153 2:168533342-168533364 TGGAATAGTTTGGAATAGTTTGG + Intronic
941694154 2:168533352-168533374 TGGAATAGTTTGGAATAGACTGG + Intronic
941694156 2:168533372-168533394 TGGAATAGTTTGGAATAGATTGG + Intronic
941833388 2:169988441-169988463 TGGAATTGTTTAATATTTATTGG - Intronic
942162357 2:173204690-173204712 TGGTATAGATTAAAATGGATTGG + Intronic
942214156 2:173701934-173701956 TGGAATAGTTTCAGAAAGAATGG + Intergenic
942242441 2:173975208-173975230 TGGAATAGTTTGGAATGGATGGG - Intergenic
942544656 2:177050719-177050741 TGAATTAGTTCAATCTAGATTGG + Intergenic
942868339 2:180703679-180703701 TGGAAAAGTTTGAGAAAGATTGG + Intergenic
943276962 2:185879894-185879916 TGGAATAGTTTCAGTAAGATTGG - Intergenic
943607482 2:189993554-189993576 TGGAATAGTTTCAGTAAGATTGG + Intronic
943943784 2:194032390-194032412 TGGAATAGTTTCAGTAAGATTGG - Intergenic
944102262 2:196040159-196040181 TGGAATAGTTTGAGAAAAATTGG - Intronic
944262796 2:197695382-197695404 TGGAACAGTTTAAGTAAGATTGG + Intronic
944390465 2:199213197-199213219 GGGAATAGTTTAAGAAGGATTGG + Intergenic
945131718 2:206580770-206580792 TGGAATAGTGTCATAAGGATTGG + Intronic
945329406 2:208522105-208522127 TGGAATAGTTTCAGAAAGAATGG + Intronic
945615263 2:212058378-212058400 TGGAATAGTTTTATAAGGAATGG - Intronic
945777003 2:214117438-214117460 TGGAATAGTTTGAGAAACATTGG - Intronic
945861375 2:215126352-215126374 TGGAATAGTTTCAAAAGGATTGG + Intronic
945861783 2:215131287-215131309 TGGAATAGTTTCACCAAGATTGG + Intronic
946501587 2:220253327-220253349 TGGAATAGTGTCAAAAAGATTGG - Intergenic
947241918 2:228004114-228004136 TGGAATAGTTTCAAAAAGATTGG + Intronic
948568253 2:238900028-238900050 TGGAATAGTTTAATATAGATGGG + Intronic
1169391042 20:5191520-5191542 CGGAATAGTTTGATATATTTGGG - Exonic
1169396715 20:5238309-5238331 TGGAATAGTTTCAGATGGAATGG + Intergenic
1169397642 20:5247864-5247886 TGGAATAGTTTCATCAAGATTGG + Intergenic
1170245488 20:14217561-14217583 TGGAATAGTTTCAAAAGGATTGG + Intronic
1170384656 20:15803098-15803120 TGGAATAGTTTGAGAAAAATTGG - Intronic
1170862856 20:20124772-20124794 TGGAATAGTGTCAGAAAGATTGG + Intronic
1172309200 20:33904403-33904425 TGGAATACTTTAATATTTATTGG + Intergenic
1173318595 20:41967622-41967644 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1174973884 20:55308791-55308813 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1175041280 20:56053470-56053492 TGGAATAGTTTCAGATGGAATGG - Intergenic
1175434596 20:58934974-58934996 TGGAAGAGTTTGAGATGGATTGG - Intergenic
1176316969 21:5255367-5255389 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1176525606 21:7865419-7865441 TGGAATAGTTTCAGTAAGATTGG + Intergenic
1176777026 21:13146671-13146693 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1176918156 21:14651117-14651139 TGGAATAGTTTGAGTAAGATTGG - Intronic
1177045493 21:16163759-16163781 TGGATTACTTTAATATTTATGGG + Intergenic
1177463563 21:21444385-21444407 TGGAATCGTTTCAGATAGAATGG + Intronic
1178039140 21:28620320-28620342 TGGAATAGTTTAAGAAGGAATGG + Intergenic
1178659626 21:34495432-34495454 TGGAATAGTTTCAGTAAGATTGG + Intergenic
1179432445 21:41332575-41332597 TGGAAGAGTTTGAAATTGATTGG + Intronic
1180254352 21:46613806-46613828 TGTATTTGTTTAATAGAGATGGG + Intergenic
1185306902 22:50123708-50123730 TGGAAAAGTTTGAGAAAGATTGG + Intronic
949149978 3:754874-754896 TGGAATAGTTTCAGGAAGATTGG + Intergenic
949298056 3:2549752-2549774 TGGAATAGTTTCAGAAAGAATGG + Intronic
950500691 3:13361741-13361763 TGGAATAGTTTAATGCACAAGGG - Intronic
950592101 3:13944725-13944747 TGGAATAGTGTCAAAAAGATTGG + Intronic
951151108 3:19290800-19290822 TGGAATAGTTTCAGAAAGAATGG + Intronic
951777885 3:26329888-26329910 TGGAATAGTTTAAGTAATATTGG - Intergenic
951809993 3:26688390-26688412 AGGAATAGGCTAATACAGATGGG - Intronic
951843034 3:27055031-27055053 TGGAATAGTTTAAGTCAGATTGG + Intergenic
952005571 3:28838676-28838698 TGGAGTAGTTTGAATTAGATAGG + Intergenic
952106027 3:30070221-30070243 TGGAAAAGTTTACTATTAATAGG - Intergenic
952250862 3:31652264-31652286 TGGAATAGTTTGAGAAAGACTGG - Intergenic
952503402 3:33985736-33985758 TGGAATAGTTTCAGAAAGAATGG + Intergenic
952565398 3:34651352-34651374 AGGAATTGTTTACTTTAGATGGG - Intergenic
953195495 3:40728637-40728659 TGGAATAGTTTCAGTAAGATTGG + Intergenic
953264607 3:41374225-41374247 TGGAATAGTTTAAGAAGGAAAGG - Intronic
954094188 3:48310826-48310848 TGGAAGAGTTTAAGAAAGATTGG - Intronic
954485463 3:50846558-50846580 TGGAATAGTTTCAGTAAGATTGG + Intronic
954488743 3:50880715-50880737 TGGAATAGTTTCAGAAAGAATGG - Intronic
954494399 3:50940854-50940876 TGGAATAGTTGGATATTCATAGG + Intronic
954501148 3:51015677-51015699 TGGAATAGTTTGATTAGGATTGG + Intronic
956072075 3:65463679-65463701 TGGAATAGTTTCAGAAAGAATGG + Intronic
956567910 3:70660267-70660289 TGGAATAGTTTCAGAAAGAATGG - Intergenic
956984984 3:74688371-74688393 TGGAATAGTTTTATAAGGAATGG - Intergenic
957113904 3:76000450-76000472 TGGAATATTTTAATTTAATTCGG - Intronic
957308628 3:78490589-78490611 TGGAATAGTTTCAGAAAGAATGG - Intergenic
957344896 3:78948111-78948133 TGGAATAGTTTAAGAAGGAATGG - Intronic
957370893 3:79292929-79292951 TGGAATAGTTTCAGAAAGAATGG + Intronic
957515291 3:81242697-81242719 TGAAATATATTAATTTAGATTGG + Intergenic
957541463 3:81575236-81575258 TGAAATAATTGAATATAGAAGGG - Intronic
957613512 3:82498922-82498944 TGGAATAGTTTCAATAAGATTGG - Intergenic
957613835 3:82504060-82504082 TATAATATTTTAATATAAATTGG - Intergenic
957658172 3:83110043-83110065 TGGAATAGTTTCAGAAGGATTGG - Intergenic
957721729 3:84011188-84011210 TGGAATAGTTTCATAATGAATGG - Intergenic
957722067 3:84014728-84014750 TTGAAAAGTTTAAGAAAGATTGG - Intergenic
957879078 3:86186986-86187008 TGGAATAGTTTCATCAGGATTGG - Intergenic
958204467 3:90371925-90371947 TGGAATAGTTTCAGAAGGATTGG + Intergenic
958447935 3:94237880-94237902 TGGAATAGTTTCAGAAAGAATGG + Intergenic
958726035 3:97907299-97907321 TGGAATAGTTTCAAAAGGATTGG + Intronic
959227721 3:103607074-103607096 TGGAATAGTTTGAGAAGGATTGG - Intergenic
959577741 3:107952691-107952713 TAGAATAGCTTAATAAATATTGG - Intergenic
959740445 3:109712407-109712429 TGGAAAAGATTAACATAGGTTGG - Intergenic
959838339 3:110947305-110947327 TGGAAGAGTTTGAGAAAGATTGG - Intergenic
960260947 3:115567608-115567630 TGGAATAGTTTGAGAAAAATTGG - Intergenic
960775357 3:121245223-121245245 TGTTATAGTTTAAAATAGATTGG + Intronic
962287350 3:134098267-134098289 TGGAATAGTTTCAGAAGGATTGG + Intronic
962643823 3:137416169-137416191 TGGAATAGTTTCAGAAAGAATGG - Intergenic
962774172 3:138643269-138643291 TGGAATAGTTTGATAAAAGTTGG + Intergenic
962861905 3:139411260-139411282 TGGAATAGTTTCAGTAAGATTGG + Intergenic
962899748 3:139750601-139750623 TGGAATAGTTTGAAAAAGATTGG - Intergenic
963023325 3:140893856-140893878 TGGAATAGTTTCAGTAAGATTGG + Intergenic
963101051 3:141604298-141604320 TGGAATAGTTGAGCATATATGGG + Intronic
963571676 3:147005217-147005239 TGTAATAGTTTAAGTAAGATTGG + Intergenic
963623218 3:147638251-147638273 TGGAATAGTTTCAGTAAGATTGG - Intergenic
963655413 3:148042612-148042634 TGGAAAAGTGTAAAATAGTTGGG - Intergenic
963879211 3:150509395-150509417 TGGAATAGTTTGAGAAAAATTGG - Intergenic
964053476 3:152423521-152423543 TGGAATAGTTTCAGAAAGAATGG - Intronic
964075935 3:152691887-152691909 TGGAATTGTTTCATTGAGATTGG - Intergenic
964699883 3:159554321-159554343 TGGAAGAGTTTTATATAAACTGG + Intronic
964954949 3:162342385-162342407 TGGAATAGTTCAATAATAATCGG + Intergenic
964997068 3:162895059-162895081 TGGAATAGTTTGAGATGAATTGG - Intergenic
965102508 3:164318479-164318501 TGGAATAATTTTATAAAAATTGG - Intergenic
965254758 3:166391793-166391815 TGGAATAGTTTCAGTAAGATTGG + Intergenic
965345438 3:167543228-167543250 TGGAATAGTTTCAGTAAGATTGG - Intronic
965656560 3:170991198-170991220 TGGAATAGTTTCAGTAAGATTGG - Intergenic
965706854 3:171517592-171517614 TGGAATAGTTTCAGAAAGAATGG + Intergenic
965985267 3:174745526-174745548 TGGAATAGTTTCATAAGGAATGG - Intronic
966082648 3:176023148-176023170 TGTAATATTTTAATATATATAGG + Intergenic
966574214 3:181481217-181481239 TGGAATAGTTTCAGAAAGAATGG - Intergenic
967553457 3:190826815-190826837 TAGAAAAGTTTGATATAGAATGG - Intergenic
967753538 3:193142048-193142070 TTGTATGGTTTAATAGAGATGGG + Intergenic
969908306 4:10418279-10418301 AGGGATATTTGAATATAGATTGG + Intergenic
969929028 4:10612236-10612258 AGGAAGAGTTCAATACAGATTGG + Intronic
970184512 4:13435812-13435834 TGGAATAGTTTCAGTAAGATTGG - Intronic
970288242 4:14542497-14542519 TGGAATAGTTTCAGAAAGAATGG - Intergenic
970338403 4:15078504-15078526 TGGAAGAGTTTAAGAAGGATTGG - Intergenic
970354103 4:15235344-15235366 GGGAAAACTTTAATTTAGATAGG + Intergenic
970749449 4:19339838-19339860 TGGAATAGTTTCAGAAAGAATGG + Intergenic
970750199 4:19350006-19350028 TGGAATAGATTAATCCAGAACGG + Intergenic
970917786 4:21355740-21355762 TGGAATAGTTTCAGAAAGAATGG - Intronic
970971831 4:21993338-21993360 TGGAAGAGTTTAAGAAAGATTGG - Intergenic
971438327 4:26652266-26652288 TGGAATAGTTTCAGAAAGAATGG + Intronic
972717900 4:41666708-41666730 AGTAATAGTTTACTACAGATGGG - Intronic
972918984 4:43914680-43914702 TGGAATAGTTTCATTAAGAATGG - Intergenic
972972678 4:44596656-44596678 TGGAATAGTTTCAGAAAGAATGG - Intergenic
973347381 4:49071422-49071444 TGGAATAGTTTCAGAAAGAATGG - Intergenic
973568750 4:52215703-52215725 TGGAATAGTTTCAGAAAGAATGG + Intergenic
973654637 4:53033901-53033923 TGGAATAGTTTCAGAAAGAATGG - Intronic
973811697 4:54576960-54576982 TAGAATAATTTTTTATAGATAGG + Intergenic
973893349 4:55389495-55389517 TGGAAGAGTCTATTTTAGATGGG + Intergenic
974347382 4:60699406-60699428 TGGAATAGTTTCAGAAAGAATGG - Intergenic
974376076 4:61077856-61077878 TGGAATAGTTTCAGTAAGATTGG - Intergenic
974410505 4:61535489-61535511 TGGATTAGTTTCATTAAGATTGG + Intronic
974512158 4:62857286-62857308 TACAATAGTCTAATATAGTTTGG + Intergenic
974780672 4:66548683-66548705 TGGAATAGTTTCAGAAAGAATGG - Intergenic
974905847 4:68055662-68055684 TGGAAGAGTTTAAGAAAGATTGG - Intronic
974959505 4:68680055-68680077 TGGAATAGTTTCAGAAAGAACGG + Intergenic
975093806 4:70434273-70434295 TGGAATAGTTTCAGAAAGAATGG + Intronic
975249891 4:72166328-72166350 TGGAATAGTTTCATAACGAATGG + Intergenic
975274302 4:72478130-72478152 TGGAATAGTTTCAGAAAGAATGG - Intronic
975277330 4:72517389-72517411 TGGAATAGTTTCAGAAAGAATGG + Intronic
975308994 4:72881320-72881342 TGGAATAGTTTCAGAAAGAATGG + Intergenic
975321707 4:73015818-73015840 TGGAATAATTTTATCTAGTTGGG - Intergenic
975410911 4:74048511-74048533 TGGAATAGTTTCAAGTGGATTGG + Intergenic
976112152 4:81687190-81687212 TGGAAAAGTTTAATTTAGGAAGG + Intronic
976328624 4:83802063-83802085 TGGATTAATGTAATATATATTGG - Intergenic
976336970 4:83900040-83900062 TGGAATGGTTTCATATATAGAGG - Intergenic
976368777 4:84262638-84262660 TGTAATAGTTTCATTTAGATTGG - Intergenic
976552277 4:86410455-86410477 TGGAATAGTTTCAGAAAGAATGG + Intronic
976998540 4:91465941-91465963 TGGAATAGTTTCAGAAAGAATGG - Intronic
977154818 4:93558673-93558695 TGGAATAGTTTCAGAAAGAATGG - Intronic
977481593 4:97584951-97584973 TGGAATAGTTTCAGTAAGATTGG - Intronic
977482989 4:97602368-97602390 TGGAATAGGTCTATACAGATTGG - Intronic
977496496 4:97781520-97781542 TGGAATAGTTTCAGAAGGATTGG - Intronic
977671723 4:99702649-99702671 TGGAATAGTTTCAGAAAGAAAGG - Intergenic
977885563 4:102249159-102249181 TTTAATAGATTAATAGAGATGGG + Intergenic
977895385 4:102358684-102358706 GGGAATAATTTAGTATAGAGTGG - Intronic
977906865 4:102487035-102487057 TGGAATAGTTTCATTAAAATTGG - Intergenic
977946791 4:102922996-102923018 TGGAATAGTTTCAGAAAGAATGG - Intronic
978013063 4:103711080-103711102 TGGAATAGTTTCATAAGGAATGG - Intronic
978017851 4:103769611-103769633 TGGAAGAGTTTTAGAAAGATTGG + Intergenic
978090628 4:104710460-104710482 TGGAATAGTTTCAGACAGAATGG - Intergenic
978097912 4:104802348-104802370 TGGAATAGTTTCAGAAAGAATGG - Intergenic
978137923 4:105285272-105285294 TGGAATAGTTTCAGAAACATTGG + Intergenic
978893369 4:113855725-113855747 TGGAATAGTTTAAGAAGGAATGG - Intergenic
978930007 4:114298501-114298523 TGGAATAGTTTGAGAAGGATTGG + Intergenic
978971261 4:114809207-114809229 TGGAATAGTTTCAGAAAGATTGG - Intergenic
979225177 4:118276820-118276842 AAGAATATTTTAATATAGATAGG + Intergenic
979339746 4:119508186-119508208 AGGAACATCTTAATATAGATGGG + Intronic
979423311 4:120532936-120532958 TGGAATAGTTTAAGAAGGAATGG + Intergenic
979457935 4:120947657-120947679 TGGAATAGTTTCAGATGGAATGG - Intergenic
979471453 4:121102877-121102899 TGGAAGAGTTTAAGATGGATTGG + Intergenic
979584578 4:122400557-122400579 TGGAATAGTTTCAGTAAGATTGG + Intronic
980031951 4:127842020-127842042 TGTAATAGTTACAAATAGATTGG + Intergenic
980090090 4:128434059-128434081 TGGAATAGTTTCAGAAAGAATGG + Intergenic
980096840 4:128500624-128500646 TGGAATAGTTTGAGATGAATTGG + Intergenic
980186799 4:129472215-129472237 TGGAATAGTTTCAGTAAGATTGG + Intergenic
980231214 4:130048753-130048775 TGGAATAGTTTCATAAGGAATGG + Intergenic
980568106 4:134572571-134572593 TGGAATAGTTTCAGAAAGAATGG - Intergenic
980637397 4:135525899-135525921 TGGAATAGTTTCAGAAAGAATGG - Intergenic
981126044 4:141107727-141107749 TGGAAGATTTTAATATGGAGAGG - Intronic
982039188 4:151378515-151378537 TGGAATAGTTTCAGGAAGATTGG - Intergenic
982047717 4:151465460-151465482 TGGAATAGTTTCAGAAGGATTGG - Intronic
982312313 4:153998407-153998429 TGGAATAGTTTAAGAAGAATTGG + Intergenic
982670111 4:158310607-158310629 TGGAATAGTTTTAGCAAGATTGG + Intergenic
982841439 4:160192728-160192750 TGGAATATTTGAATATAAATTGG + Intergenic
983022499 4:162695713-162695735 TGGAATAGTTTAAGAAGAATTGG + Intergenic
984092388 4:175390119-175390141 TGGAATAGTTTCATAAGGAATGG - Intergenic
984268586 4:177523734-177523756 TGGAATAGTTTCAGAAAGAATGG - Intergenic
984751410 4:183279529-183279551 TGGAATAGTTTCAGAAAGATTGG + Intronic
984799663 4:183702617-183702639 TGGAAAAGTATAAAATACATAGG + Intronic
985157723 4:187008882-187008904 TGGAAGAGTTTAAGAAAGATTGG + Intergenic
985246676 4:187985977-187985999 TGGCATAGTTTAATATTTAGCGG + Intergenic
985329814 4:188818766-188818788 TAGAATAGATTAGTATAGATGGG + Intergenic
985581492 5:697773-697795 TGGAATAGTTTCAGAAGGATTGG - Intergenic
985596119 5:789101-789123 TGGAATAGTTTCAGAAGGATTGG - Intergenic
986110692 5:4713364-4713386 TGGAATAGTTTAATAGTTTTAGG - Intergenic
986149757 5:5116858-5116880 TGGAATAGTTTCAGTAAGATTGG + Intergenic
986656061 5:10013584-10013606 TGGAATAGTTTCAGAAAGAATGG + Intergenic
987013726 5:13795638-13795660 TGGAATAGTTTCAGAAAGAATGG - Intronic
987106338 5:14643493-14643515 TGGAATAGTTTCATGAAGATTGG + Intergenic
987654287 5:20785452-20785474 TTTAATAGTTTCATATAGCTTGG + Intergenic
987823327 5:22993807-22993829 TGGAATAGTTTGATTAGGATTGG + Intergenic
988052738 5:26051805-26051827 TGGAATAGATTTATGTGGATTGG - Intergenic
988741349 5:34076351-34076373 TTTAATAGTTTCATATAGCTTGG - Intronic
989253948 5:39346609-39346631 TGGAATAGTTTCAGAAAGAGTGG - Intronic
989473424 5:41847368-41847390 TGGAATAGTTTAAGAAGGAATGG - Intronic
989663715 5:43826473-43826495 TGGAATAGTTTAATGAGGATTGG + Intergenic
989679999 5:44017309-44017331 TGGAATAGTTTCAGAAAGAATGG - Intergenic
989789550 5:45380464-45380486 TGGAATAATTTAAGTTACATAGG + Intronic
989968939 5:50498171-50498193 TGGAATAGTTTCAGATGGAATGG - Intergenic
990098269 5:52147795-52147817 AGGAATATTTTAAAATGGATTGG - Intergenic
990134295 5:52626714-52626736 TGGAATAGTTTCAGAAGGATTGG + Intergenic
990337599 5:54790290-54790312 TGGAATAGTTTCAGAAAGAATGG + Intergenic
990359161 5:55000504-55000526 TGGAATAGTTTCAGAAAGAATGG - Intronic
990674005 5:58162875-58162897 TGAAATAGTTTCACAGAGATTGG + Intergenic
990916617 5:60913145-60913167 TGGAATAGTTTCAGAAAGAATGG + Intronic
990927629 5:61046349-61046371 TGGAAGAGTTTAAGAAGGATTGG + Intronic
991210810 5:64102607-64102629 TGGAATAGTTTCAGAAAGAATGG - Intergenic
991402471 5:66267209-66267231 TGGAAGAGTTTGAGAAAGATTGG + Intergenic
992220808 5:74570874-74570896 TGGAATAGTTTCATTAGGATTGG + Intergenic
992275904 5:75118008-75118030 TTGAAGAGTTTAATAAACATAGG + Intronic
992287731 5:75252538-75252560 TGGAATAGTTTCAGAAAGAATGG + Intergenic
992453941 5:76898845-76898867 TGGAATAGTTTGAGTAAGATTGG + Intronic
992652156 5:78870252-78870274 TGGAATAGTTTCAGAAAGAATGG - Intronic
992670189 5:79052353-79052375 TGGAAGAGTTTGAGAGAGATTGG + Intronic
992675115 5:79098444-79098466 TGGAATAGTTTCAGAAAGAATGG + Intronic
992972297 5:82074133-82074155 TGGAATAATTTTATATAGAATGG - Intronic
993459903 5:88170568-88170590 TGGAATAGTTTCAGAAAGAATGG + Intergenic
993500851 5:88665274-88665296 TGGAATAGTCTCAGCTAGATGGG - Intergenic
993634603 5:90328167-90328189 TGGAATAGTTTCAGGAAGATTGG + Intergenic
994207684 5:97053731-97053753 TGGAATAGTTTAAGTAGGATTGG + Intergenic
994575501 5:101573995-101574017 TACAATAGTTTAATATCGTTGGG - Intergenic
994636030 5:102345249-102345271 TGGAACAGTTTAAACTAAATAGG - Intergenic
994688904 5:102992033-102992055 TGGAATAGTTTAATAGAAAAAGG + Intronic
994715112 5:103311656-103311678 TGGAATAGTTTCAGAAGGATTGG + Intergenic
995105697 5:108375713-108375735 TGGAAGAATTTAAGATAGATTGG - Intronic
995117130 5:108493994-108494016 TGGAATAGTTTCAGATGGAATGG - Intergenic
995276261 5:110281206-110281228 TGGAATAGTTTCAGAAAGAATGG + Intergenic
995416322 5:111917297-111917319 TGGAATAGTTTCAGAAAGAATGG - Intronic
995586024 5:113649387-113649409 TGGAATAGTTTCAGAAAGAATGG - Intergenic
996141057 5:119909838-119909860 TGGAATAGTTTAAGTGAGATTGG + Intergenic
996194017 5:120581074-120581096 TGGAATAGTTTCAGAAAGAATGG + Intronic
996859403 5:128047496-128047518 TGGAATAGTTTCAGAAAGAATGG - Intergenic
997021783 5:130011063-130011085 TGGAATAGTTTCAGAAGGATTGG - Intronic
997135001 5:131315895-131315917 TGGATCAGTTAATTATAGATGGG + Intronic
997520437 5:134520443-134520465 TGAAATAGTTCAAGATAGAGAGG - Intergenic
1000016394 5:157281429-157281451 TGGTATAGTTTAAGAAAGACAGG + Intronic
1000490300 5:161904589-161904611 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1000587278 5:163115934-163115956 TGGAACACTTTAAGATAAATTGG + Intergenic
1000591923 5:163168627-163168649 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1000914352 5:167062248-167062270 TGTAATAGTTGAATATCGCTTGG + Intergenic
1001177937 5:169489997-169490019 TGGAATAGTTTGAGTAAGATTGG - Intergenic
1001261764 5:170235649-170235671 AGGAATTGTTTAAAATAGAATGG - Intronic
1001343969 5:170873400-170873422 TGGAATAGTTTCAGAAAGAATGG + Intronic
1001737287 5:174016611-174016633 TGGAATAGTTTAAGAAGGAATGG + Intergenic
1002413586 5:179104517-179104539 TGGAATAGTTTAAGAAGGAATGG - Intergenic
1002681963 5:180972309-180972331 TGGAAAAGTTTAAGAAGGATTGG - Intergenic
1003449213 6:6215118-6215140 TGGAATAGTTTCAGAAAGAATGG - Intronic
1003510979 6:6780129-6780151 TGGAAAAGTTGAATATAAATAGG - Intergenic
1004152072 6:13130745-13130767 TGGAATAGTTTCAGTAAGATTGG - Intronic
1004391626 6:15214867-15214889 TGGAGTATTTTAAAATAAATTGG - Intergenic
1004440428 6:15645375-15645397 TGGAATAGTTTCAGTAAGATTGG - Intronic
1004822402 6:19381777-19381799 TGAAATAAACTAATATAGATAGG - Intergenic
1005208190 6:23429229-23429251 TGGAATAGTTTCATAAGGAATGG + Intergenic
1005377188 6:25195065-25195087 TGGCATAGTTTCGTATAGTTTGG - Intergenic
1005558456 6:27012002-27012024 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1005878077 6:30030425-30030447 TGGAATAGTTTCAGATGAATTGG + Intergenic
1006477350 6:34265349-34265371 TGGAAGAGTTTAGGAAAGATTGG - Intergenic
1007526349 6:42497607-42497629 TGGAATAGTTTCAGTAAGATTGG + Intergenic
1007954832 6:45907576-45907598 TGGAATAGTTTAAGTACGATTGG + Intronic
1008183830 6:48366544-48366566 TGGAATAGTTTCAGAAGGATTGG - Intergenic
1008452488 6:51669099-51669121 TGGAATAGTTTCAGATGGAATGG + Intronic
1008491703 6:52093499-52093521 TGGAATAGTTTCAGATGGAATGG + Intergenic
1008529674 6:52444842-52444864 TGGAATAGTTTCAGAAAGAATGG + Intronic
1008566476 6:52773782-52773804 TGGAATAGTTTCAGAAGGATTGG + Intergenic
1008782279 6:55122016-55122038 TGGAATAGTTTCAGAAAGAATGG + Intronic
1009054635 6:58319996-58320018 TGGAATAGTTTCAGAAAGAGCGG - Intergenic
1009236502 6:61130574-61130596 TGGAATAGTTTCAGAAAGAGCGG + Intergenic
1009341210 6:62557161-62557183 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1009605780 6:65865436-65865458 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1009687962 6:66987768-66987790 TAAAATATTTTAATATATATAGG + Intergenic
1010054844 6:71553083-71553105 TGGAATAGTTTCAGAAAGATTGG + Intergenic
1010312214 6:74400747-74400769 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1010312629 6:74405490-74405512 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1010512276 6:76735501-76735523 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1010575246 6:77522016-77522038 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1010607529 6:77909646-77909668 TGGAATAGTTTCAGAAAGAATGG - Intronic
1010670414 6:78679889-78679911 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1010817773 6:80379030-80379052 TGGAATAGTTTCAGCAAGATTGG - Intergenic
1011137079 6:84112156-84112178 TGGAATAGTGTCATAAGGATTGG + Intergenic
1011138815 6:84130410-84130432 TGGAATAGTTTCAGAAGGATTGG + Intronic
1011324714 6:86137364-86137386 TGGAATAGTTTAAGAAGAATTGG - Intergenic
1011368999 6:86612164-86612186 TGGAAAAGCTTAAGAGAGATAGG + Intergenic
1011479086 6:87776368-87776390 TAGAATAGTTTAGCATGGATAGG + Intergenic
1011589354 6:88956481-88956503 TGGAATAGTTTCAGTAAGATTGG - Intronic
1011970558 6:93217389-93217411 TGGAATAGTTTTAGTAAGATTGG + Intergenic
1012287133 6:97404337-97404359 TGGAATATTTTCATATATAAGGG + Intergenic
1012660546 6:101884895-101884917 TGGAAGAGTTTCACATAGAATGG + Intronic
1012722278 6:102759677-102759699 TGGTATTTTTTAATAGAGATGGG + Intergenic
1012845668 6:104385004-104385026 TGGAATAGTTTCAGTAAGATTGG - Intergenic
1012848430 6:104418763-104418785 TGGAATAGATTAGAATAGATGGG + Intergenic
1013371563 6:109475283-109475305 TGGAAATGTTTATTATAAATTGG - Intronic
1013377950 6:109537157-109537179 TGGAATAGTTTCAGAAGGATTGG + Intronic
1013380697 6:109567518-109567540 TGGAATAGTTTCATAAGGAATGG - Intronic
1013381588 6:109577536-109577558 TGGAATAGTTTCAGTAAGATTGG + Intronic
1013957499 6:115857559-115857581 TGGAATAGTTTCAGATAGAATGG - Intergenic
1014205803 6:118653893-118653915 ACAAATAGTTTAATATAGTTTGG - Intronic
1014475121 6:121862588-121862610 TGGAATAGTTTTAGAAAGAATGG + Intergenic
1014685196 6:124488981-124489003 TGATATAGTTTAATAAATATTGG + Intronic
1014968751 6:127789463-127789485 TGGAATAGTTTCATAAAGAATGG - Intronic
1015200106 6:130570028-130570050 TGGAATAGTTTCAGATGGAATGG - Intergenic
1015802401 6:137073728-137073750 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1016103460 6:140131939-140131961 TGGAATAGTTTCAGAAGGATGGG - Intergenic
1016124174 6:140379374-140379396 TGGAATAGTAGAATAAAAATAGG + Intergenic
1016542743 6:145183955-145183977 TGGAATAGTTTGATTTGGATTGG - Intergenic
1018301980 6:162412828-162412850 TGGATTACTTTTGTATAGATGGG + Intronic
1019805939 7:3125116-3125138 TGGAATAGTTTCAGAAGGATTGG - Intergenic
1019855661 7:3604236-3604258 TGGAATAGTTTCAGAAGGATTGG + Intronic
1020515412 7:9111599-9111621 TGGAATAGTTTAAGTAAAATTGG - Intergenic
1020664205 7:11019287-11019309 TGGAATAGTTTGAGTAAGATTGG + Intronic
1020692980 7:11381069-11381091 TTGAATAGTTTAAAAAAGAATGG + Intronic
1021309523 7:19076206-19076228 TGGAATACTTTAAGAAAAATTGG - Intronic
1021661923 7:22927773-22927795 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1022348576 7:29543401-29543423 TGGAATAGTTTGAGTAAGATTGG - Intergenic
1022682436 7:32562250-32562272 TGTAGTATTTTAATATACATAGG - Intronic
1023887143 7:44367408-44367430 TGGAATAGTCAAATAAAGAAAGG + Intergenic
1024016310 7:45318855-45318877 TGGAATAGTTTCAGATGGAATGG - Intergenic
1024419531 7:49147368-49147390 TGAAATAGTTTCATTTGGATTGG - Intergenic
1024514521 7:50233993-50234015 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1024560060 7:50636320-50636342 TGGAATAGTTTCAGTAAGATTGG - Intronic
1024666759 7:51554685-51554707 TGGAATAGTTTCAGAAGGATTGG + Intergenic
1024679427 7:51669319-51669341 TGGAAGAGTTTAAGAAGGATTGG - Intergenic
1024756159 7:52534894-52534916 TTGAATAGTTTAATTGAAATAGG - Intergenic
1024847540 7:53665132-53665154 TGGAATAGTTTAAGTAAGATTGG + Intergenic
1025524170 7:61783754-61783776 TGGAATAGTTTCAGAAGGATTGG + Intergenic
1025547527 7:62195971-62195993 TGGAATAGTTTCAGAAGGATTGG + Intergenic
1025569948 7:62549953-62549975 TGGAATAGTTTCAGATGGAATGG + Intergenic
1025802600 7:64800734-64800756 TGGAATAGTTTTAGAAAGAATGG + Intronic
1026080899 7:67219438-67219460 TGGAAAAGTTTGAGAAAGATTGG + Intronic
1026696183 7:72594594-72594616 TGGAAAAGTTTGAGAAAGATTGG - Intronic
1027450700 7:78327736-78327758 TTGAATAGTTGATAATAGATGGG + Intronic
1027871522 7:83713954-83713976 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1028277566 7:88875748-88875770 TGGAATAGTTTCAGATGGAATGG - Intronic
1028508215 7:91593232-91593254 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1028522823 7:91751181-91751203 TGGAATAGTTTTAGATAAATTGG - Intronic
1028644779 7:93083364-93083386 TGGAATAGTTTCAATAAGATTGG - Intergenic
1028776265 7:94680656-94680678 TGGATTAGTTTAATTCAGTTTGG - Intergenic
1028782568 7:94754159-94754181 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1028919156 7:96291866-96291888 TGGAATAGTTTCAGAAAGAATGG - Intronic
1028929040 7:96392424-96392446 TGGGATATTTTAATACAGGTAGG + Intergenic
1029039811 7:97561111-97561133 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1029310244 7:99656634-99656656 TGGAATAGTTTCAGAAAGAATGG + Intronic
1029319429 7:99744967-99744989 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1030178138 7:106676044-106676066 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1030462731 7:109861080-109861102 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1030467510 7:109921589-109921611 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1031641138 7:124165459-124165481 TGGAATAGTTTCAGTAAGATTGG - Intergenic
1031676048 7:124613707-124613729 TGGAATAGTTTCAGTAAGATTGG - Intergenic
1031700865 7:124924561-124924583 TGGAATAGTTTCAGGTGGATTGG - Intronic
1031905354 7:127454529-127454551 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1032290330 7:130583900-130583922 TGGAATAGTTTCAAAAGGATTGG - Intronic
1032659407 7:133966879-133966901 TGGAATAGTTTCATAAGGAATGG + Intronic
1032689511 7:134269120-134269142 TGGAATAGTTTCAGTAAGATTGG - Intergenic
1033624148 7:143091851-143091873 TGGAATAGTTTCATAAGGATTGG - Intergenic
1033893095 7:146039514-146039536 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1034019871 7:147630411-147630433 TGGAATAGTTTCAGTAAGATTGG - Intronic
1034236623 7:149576356-149576378 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1035753657 8:2013657-2013679 TGGAATAGTTTGAGGAAGATTGG + Intergenic
1035877653 8:3208957-3208979 TGGAATAGTTACATATATAAAGG - Intronic
1035885912 8:3291379-3291401 TGGAATAATTGAATAAGGATTGG + Intronic
1037034490 8:14148627-14148649 TGGAATAGTTTGAGTAAGATTGG - Intronic
1038243009 8:25827748-25827770 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1038474089 8:27850674-27850696 TGGAATAAATTAATAAACATAGG + Intergenic
1038923676 8:32114061-32114083 TAGAATAGTTTCATGTAGTTGGG + Intronic
1039744979 8:40416707-40416729 TGGAATATTTTAAGAATGATGGG - Intergenic
1040364545 8:46701816-46701838 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1040612963 8:49004086-49004108 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1040769314 8:50953750-50953772 TGGAATAGTTTCAGAAAGAAGGG + Intergenic
1040797702 8:51304230-51304252 TGCAAGAGTTTAATATTTATAGG + Intergenic
1040867741 8:52067124-52067146 TGGAATAGTTTCAGTAAGATTGG + Intergenic
1041002568 8:53466709-53466731 TGGACTGGTTTAACAGAGATTGG - Intergenic
1041689539 8:60675748-60675770 TGGAAACATTTAATATAGATAGG + Intergenic
1041872434 8:62649876-62649898 TGCAGTTGTTTAAAATAGATGGG - Intronic
1041885610 8:62804201-62804223 TGGAATAGTTTCAGACAGAATGG - Intronic
1042023199 8:64393416-64393438 TGGAATGGTAGGATATAGATAGG - Intergenic
1042143573 8:65704088-65704110 TGAAATACTTTAATATTTATGGG - Intronic
1042300789 8:67278545-67278567 TGGAATAGATTAAACTGGATAGG + Intronic
1042413895 8:68497498-68497520 TGGAATAGATTCATAGAAATAGG - Intronic
1043308714 8:78830785-78830807 TGAAATTATTTAATATATATTGG - Intergenic
1043537523 8:81222376-81222398 TGGAATAGTTTCAGTAAGATTGG + Intergenic
1043688387 8:83117258-83117280 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1043708624 8:83384555-83384577 TGGAAGAGTTTAAGAAAGATTGG - Intergenic
1043768191 8:84163842-84163864 TGGTATTTTTTAATAGAGATGGG + Intergenic
1043819633 8:84846566-84846588 TGGAATAGTTTCAGTTGGATTGG + Intronic
1044043742 8:87402858-87402880 TGCAATAGTTAAATGTAGTTTGG + Intronic
1044312493 8:90709963-90709985 GGAAATAGTTTTATATAAATGGG - Intronic
1044455069 8:92383976-92383998 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1044939928 8:97331699-97331721 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1045459815 8:102415661-102415683 TGTAAAAGTTGAACATAGATGGG - Intergenic
1045705132 8:104913750-104913772 TGGAATAGTTTCAGAAAGAATGG + Intronic
1045764443 8:105649934-105649956 TGGAATAGTTTCAGAAAGAATGG + Intronic
1046149572 8:110205570-110205592 TGGAAAAGTTTGAGACAGATAGG - Intergenic
1046254285 8:111675811-111675833 TGGAATAGTTTCAGATGGAATGG + Intergenic
1046342384 8:112876267-112876289 TGGAATAGTTTTAGAAAGAATGG - Intronic
1046383772 8:113483016-113483038 TGGAATAGTTTAATTGAAACTGG + Intergenic
1046441192 8:114256618-114256640 TGGAATAGTTTGAGAAGGATTGG - Intergenic
1046475092 8:114731752-114731774 TGGAATAGTTTCATAAGGAGTGG + Intergenic
1046498476 8:115044510-115044532 TGGAATAGTGTCATAAGGATTGG - Intergenic
1046576056 8:116030340-116030362 TGGAATGGCTGAATTTAGATAGG + Intergenic
1046955375 8:120057952-120057974 TGAAATAGTTAATTTTAGATAGG + Intergenic
1047128958 8:121996490-121996512 TGTAGTATTTTAATATAAATGGG + Intergenic
1047592413 8:126341042-126341064 TGGAATAGTTTCAGTAAGATTGG - Intergenic
1047659947 8:127022603-127022625 TGGAAGAGTTTATTTAAGATTGG + Intergenic
1048147919 8:131863602-131863624 TAGAATAGTCTAATATATAGTGG + Intergenic
1048515652 8:135107754-135107776 TGGAATAGCTTAAGAAAGATTGG + Intergenic
1048630055 8:136232961-136232983 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1048713767 8:137243952-137243974 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1048762896 8:137816140-137816162 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1050049640 9:1585972-1585994 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1050135200 9:2455839-2455861 TGGAATAGTTTAAACAGGATTGG - Intergenic
1050590756 9:7157908-7157930 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1050639589 9:7653155-7653177 TGGAATAGGTTATTTTATATGGG + Intergenic
1050852389 9:10303851-10303873 TGGAATAGTTTCAGAAAGAAAGG - Intronic
1051081932 9:13304036-13304058 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1051082760 9:13312091-13312113 TGTAATACTTTAAAATACATTGG + Intergenic
1051456576 9:17265591-17265613 TGGAATAGTTTCAGATGGAGTGG + Intronic
1051881440 9:21844317-21844339 TGGAATAGTTTCAGTAAGATTGG - Intronic
1051924656 9:22309301-22309323 TGGATTAGCTTACTATTGATAGG + Intergenic
1052110584 9:24577092-24577114 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1052129075 9:24819013-24819035 TAGATTAGATTAATATACATGGG + Intergenic
1052257947 9:26481408-26481430 TGGAATAGTTTCATAAGGATTGG - Intergenic
1052445101 9:28551441-28551463 TGAAATAGTTTAATAGAGGTAGG + Intronic
1052667682 9:31515929-31515951 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1052724592 9:32214382-32214404 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1052884937 9:33636173-33636195 TTGAATATATAAATATAGATAGG - Intergenic
1053358715 9:37467755-37467777 TGTACTTTTTTAATATAGATGGG - Intergenic
1054895895 9:70310563-70310585 TGGAATGGTTAAATAAACATTGG + Intronic
1055236689 9:74131218-74131240 GGGACTATTTTAATATAGAGAGG + Intergenic
1055345336 9:75330020-75330042 TGGAATAGTTTCAGAAACATTGG - Intergenic
1055562960 9:77539560-77539582 TGGAATAGTTTCAGGAAGATTGG + Intronic
1055782058 9:79830814-79830836 TGTATTTTTTTAATATAGATGGG + Intergenic
1056379683 9:86045987-86046009 TTTAATAGTTTAATATTGCTTGG + Intronic
1056450106 9:86708572-86708594 TGGAATAATTTAACAGAGAAAGG - Intergenic
1056772587 9:89490780-89490802 TAGATTAGATTATTATAGATTGG - Intronic
1057639620 9:96805401-96805423 TGGAAGAGTTTAAAAAGGATTGG - Intergenic
1058084747 9:100736623-100736645 TGGAATAGTGTCAAAAAGATTGG + Intergenic
1058243540 9:102597419-102597441 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1058273921 9:103015827-103015849 TGGAATAGTATAATAGATATTGG - Intronic
1058366724 9:104217730-104217752 TGGAATAGTTTCAGATGGAATGG + Intergenic
1058512378 9:105733520-105733542 TGGAAGAGTTTAAGAAATATTGG + Intronic
1058980544 9:110165680-110165702 TGGAAACGTTTAGTATAGCTTGG - Intronic
1059194473 9:112357887-112357909 TGGAAGAGTTGGAGATAGATGGG + Intergenic
1059807596 9:117820100-117820122 TGGAATAGTTTCAGATGAATTGG + Intergenic
1060434167 9:123579434-123579456 TGGAATAGTTTTAGTTAGGTGGG + Intronic
1060865872 9:126996620-126996642 TGGAATAGTTTCAGAAGGATTGG - Intronic
1203415234 Un_KI270582v1:415-437 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1203678003 Un_KI270756v1:39501-39523 TGGAATGGATTCATATAGAATGG - Intergenic
1203678050 Un_KI270756v1:39896-39918 TGGAATGGATTCATATAGAATGG - Intergenic
1186585961 X:10873417-10873439 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1187218865 X:17304356-17304378 TGGAATAGTGTCAAAAAGATTGG + Intergenic
1187769586 X:22680399-22680421 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1187839156 X:23468335-23468357 TGGAATAGTTTGAGAAAGATTGG - Intergenic
1187839614 X:23473540-23473562 TGGAATAGTTTCATAAGGAATGG + Intergenic
1188014588 X:25094323-25094345 TGGAAGAGTTTAAGAAGGATTGG + Intergenic
1188035603 X:25314403-25314425 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1188118514 X:26276260-26276282 TGGAATAGTTTGAGTAAGATTGG + Intergenic
1188149808 X:26658350-26658372 TGGAAGAGTTTTACAAAGATTGG + Intergenic
1188223212 X:27565602-27565624 TGGAAGAGTTTAAGAAGGATTGG + Intergenic
1188658446 X:32729566-32729588 TGGAAATGTTAAAGATAGATTGG - Intronic
1188771474 X:34159062-34159084 TGGAATAGTTTCAGAAGGATTGG + Intergenic
1188851513 X:35138409-35138431 TGGAATAGTTTCATAAGGAATGG - Intergenic
1188864388 X:35296805-35296827 TGGAAAAGTTTAAGAAAGAGTGG + Intergenic
1188950943 X:36374096-36374118 TGGAAGAGTTTAATAAGGACTGG + Intronic
1189334208 X:40160610-40160632 TGGAGTTGTTTAATTTTGATTGG + Intronic
1189406105 X:40725266-40725288 TGGAATAGTTTAAGTAGGATTGG - Intronic
1189532269 X:41898023-41898045 TGGAAGAGTTTAAAATGGACTGG + Intronic
1189591456 X:42516901-42516923 TGGAATGCTTTAAAATGGATAGG + Intergenic
1189650119 X:43179619-43179641 TGGAATAGTGTCAAAAAGATTGG + Intergenic
1189873865 X:45413980-45414002 TGGAATAGTTTGAATAAGATTGG + Intergenic
1190959449 X:55231032-55231054 TGGAATAGTTTCAGTAAGATTGG - Intronic
1191032852 X:55993655-55993677 TGGAATAGTTTCTGATAGATTGG + Intergenic
1191049890 X:56180044-56180066 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1191135067 X:57055302-57055324 TGGAATATTTTCATAAAGAATGG + Intergenic
1191179847 X:57549996-57550018 TGGAATAGTTTCAGTAAGATTGG - Intergenic
1191609342 X:63094805-63094827 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1191625237 X:63263627-63263649 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1191704621 X:64081415-64081437 TGGAATAGTTTAAGAAGGAATGG + Intergenic
1191973282 X:66841561-66841583 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1192010426 X:67264773-67264795 TGGAATAGTTTCATTAGGATTGG + Intergenic
1192253704 X:69436275-69436297 TGGAATAGTTTCATAAGGAGTGG + Intergenic
1192371532 X:70517675-70517697 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1192410976 X:70931776-70931798 TTTAATAGTTTAATATTTATAGG - Intergenic
1192625326 X:72721025-72721047 TGTAAGAGTTTAATAGAGAGTGG - Intergenic
1192708062 X:73548531-73548553 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1192777706 X:74262262-74262284 TGGAACAGTTTACCTTAGATGGG - Intergenic
1192878919 X:75261610-75261632 TGGAATAGTTTCAGAAGGATAGG - Intergenic
1192927572 X:75771494-75771516 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1192938421 X:75885852-75885874 TGGAGTAGTTAATTATAGAGGGG + Intergenic
1192974040 X:76264287-76264309 TGGAATAGTTTAAGAAGGAATGG + Intergenic
1193015662 X:76730702-76730724 TGGAATAGTATCAAATAGATTGG - Intergenic
1193029851 X:76885776-76885798 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1193038767 X:76982187-76982209 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1193043501 X:77028326-77028348 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1193081224 X:77408333-77408355 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1193207991 X:78771669-78771691 TGGAATATTTTTACATAGAAAGG + Intergenic
1193284264 X:79693535-79693557 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1193364276 X:80612144-80612166 TGGAATAGTTTCAGTAAGATTGG - Intergenic
1193452447 X:81687508-81687530 TGGAATAGTTTCAGAAGGATTGG - Intergenic
1193504571 X:82326307-82326329 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1193661540 X:84264377-84264399 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1193670577 X:84380308-84380330 TGGAATAGTTTAAGTAGGATTGG - Intronic
1193672100 X:84399652-84399674 TGGAATAGTTTCAGAAAGAATGG - Intronic
1193673895 X:84423378-84423400 TGGAATAGTTTAAGTAGGATTGG - Intronic
1193835331 X:86336301-86336323 TGGAATAGTTTCAGAAAGAATGG + Intronic
1193910844 X:87304417-87304439 TGGAATAGTTTAAGAAGGAATGG + Intergenic
1193969320 X:88032203-88032225 TGGATTATTTTAATATACACAGG + Intergenic
1194016894 X:88633769-88633791 TGGAATAGTTTGAGTAAGATTGG - Intergenic
1194028532 X:88783967-88783989 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1194165983 X:90516919-90516941 TGGAATAGTTTAAGTAGGATTGG - Intergenic
1194183404 X:90740830-90740852 TGGAATAGTTTTAGAAAGAATGG - Intergenic
1194642630 X:96421252-96421274 TGGAATAGATAAATCAAGATGGG + Intergenic
1194648753 X:96489992-96490014 TGGAATAGTTTCATAAGGAATGG - Intergenic
1194657218 X:96587526-96587548 TGGAATAGTTTCAGAAGGATTGG - Intergenic
1194684895 X:96901011-96901033 TGGAATAGTTTCAGAAGGATTGG + Intronic
1194901476 X:99517300-99517322 TGGAATAGTTTCAGGAAGATGGG - Intergenic
1194937316 X:99966365-99966387 TGGAATAGTTTGAGTAAGATTGG + Intergenic
1194964309 X:100269829-100269851 TGGAATAGTTTAAGAAGGAATGG - Intergenic
1195146627 X:102024854-102024876 TGGAATAGTTTGAGAAGGATTGG - Intergenic
1195489071 X:105444948-105444970 TGGAATAGTTTCAGAAAGATTGG + Intronic
1195729882 X:107956142-107956164 TGGAATAGTTTCAGAGAGAATGG + Intergenic
1195834580 X:109099045-109099067 TGGAATAGTTTGAGTAAGATTGG + Intergenic
1196154384 X:112411291-112411313 TGGAATAGTTTACTTAGGATTGG - Intergenic
1196229029 X:113199713-113199735 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1196264412 X:113625677-113625699 TGGAATAGTTTAAACTGGATTGG + Intergenic
1196338955 X:114573054-114573076 TAGAAGAGTTTAAGAAAGATTGG - Intergenic
1196384510 X:115134508-115134530 TGGAATCGTTAAATAAACATTGG - Intronic
1196477788 X:116108882-116108904 TGGAATAGTTTCAATAAGATTGG + Intergenic
1196489378 X:116248825-116248847 TGGACTAGTTTAACAGAGAGTGG - Intergenic
1196631149 X:117941389-117941411 TGGAATAGTTTCAGAAAGAATGG + Intronic
1196633032 X:117965492-117965514 TGGAATAGTTTCAGAAAGAATGG - Intronic
1197016106 X:121627573-121627595 TGGAATAGTTTAAGTAGGATTGG - Intergenic
1197061994 X:122192175-122192197 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1197069840 X:122283342-122283364 TAGAATAGTTTAATTAGGATTGG - Intergenic
1197093704 X:122570126-122570148 AGAAATAGTTTAATATAATTGGG - Intergenic
1197191420 X:123651887-123651909 TGGAATAGTTTCAGAAAGAATGG - Intronic
1197283811 X:124570289-124570311 TGGAAAAGTTTATTTAAGATTGG - Intronic
1197501920 X:127253018-127253040 TGGAATAGTTTCAGATGGAATGG + Intergenic
1197571061 X:128151222-128151244 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1197584685 X:128330545-128330567 TGGAATAGTTTCATTAAAATTGG + Intergenic
1197613970 X:128671571-128671593 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1197990940 X:132316429-132316451 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1198418234 X:136442825-136442847 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1198852184 X:140976502-140976524 TGGGCTAGTTTTATATAAATTGG - Intergenic
1199180851 X:144852537-144852559 TGGAATAGTTTCAGAAATATTGG - Intergenic
1199283649 X:146032188-146032210 TGGAATAGTTTCAGTAAGATTGG - Intergenic
1199368022 X:147010505-147010527 TGGAATAGTTTGAGAAGGATTGG + Intergenic
1199926616 X:152473457-152473479 TGGAATAGTGTCAAAAAGATTGG - Intergenic
1199940543 X:152622141-152622163 TGGAAGAGTTTGAGAAAGATTGG - Intergenic
1200382030 X:155847928-155847950 TGGAAGAGTTTAAGAAGGATTGG - Intergenic
1200420953 Y:2966941-2966963 TGGAAAAGTTAAATTTACATAGG + Intronic
1200512253 Y:4094690-4094712 TGGAATAGTTTAAGTAGGATTGG - Intergenic
1200738227 Y:6824249-6824271 TGGAATAGTTTCAGTAAGATTGG + Intergenic
1201197266 Y:11506551-11506573 TGGAATGGATTGATATAGAATGG + Intergenic
1201238538 Y:11935433-11935455 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1201258919 Y:12138435-12138457 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1201435605 Y:13955399-13955421 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1201508405 Y:14730594-14730616 TGGAATAGTGGAATACAGAGTGG - Intronic
1201520413 Y:14867192-14867214 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1201606247 Y:15788738-15788760 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1201608997 Y:15819708-15819730 TGGAATAGTTTCATAAGGAATGG - Intergenic
1201703049 Y:16905225-16905247 TGGAATAGTTTCAGAAGGATTGG - Intergenic
1201775889 Y:17665241-17665263 TGGAATAGTTTCAGAAAGAATGG + Intergenic
1201825667 Y:18240751-18240773 TGGAATAGTTTCAGAAAGAATGG - Intergenic
1201984900 Y:19954988-19955010 TGGGATGGTTTGATATAGCTAGG + Intergenic
1202251089 Y:22873995-22874017 TGGAATAGTTTCAGATGGAATGG - Intergenic
1202404078 Y:24507744-24507766 TGGAATAGTTTCAGATGGAATGG - Intergenic
1202466701 Y:25162338-25162360 TGGAATAGTTTCAGATGGAATGG + Intergenic
1202602226 Y:26605353-26605375 TGGAATAGTTTCAGAAAGAATGG - Intergenic