ID: 948569152

View in Genome Browser
Species Human (GRCh38)
Location 2:238906711-238906733
Sequence CATCCTCCCCCCAGTGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 362}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948569144_948569152 -4 Left 948569144 2:238906692-238906714 CCCGTCCCTCCAGCTTCCACATC 0: 1
1: 1
2: 2
3: 34
4: 449
Right 948569152 2:238906711-238906733 CATCCTCCCCCCAGTGCCTGGGG 0: 1
1: 0
2: 0
3: 41
4: 362
948569146_948569152 -9 Left 948569146 2:238906697-238906719 CCCTCCAGCTTCCACATCCTCCC 0: 1
1: 0
2: 8
3: 66
4: 888
Right 948569152 2:238906711-238906733 CATCCTCCCCCCAGTGCCTGGGG 0: 1
1: 0
2: 0
3: 41
4: 362
948569143_948569152 4 Left 948569143 2:238906684-238906706 CCACGTCACCCGTCCCTCCAGCT 0: 1
1: 0
2: 0
3: 32
4: 212
Right 948569152 2:238906711-238906733 CATCCTCCCCCCAGTGCCTGGGG 0: 1
1: 0
2: 0
3: 41
4: 362
948569142_948569152 11 Left 948569142 2:238906677-238906699 CCGAGCACCACGTCACCCGTCCC 0: 1
1: 0
2: 0
3: 12
4: 117
Right 948569152 2:238906711-238906733 CATCCTCCCCCCAGTGCCTGGGG 0: 1
1: 0
2: 0
3: 41
4: 362
948569145_948569152 -5 Left 948569145 2:238906693-238906715 CCGTCCCTCCAGCTTCCACATCC 0: 1
1: 1
2: 2
3: 81
4: 934
Right 948569152 2:238906711-238906733 CATCCTCCCCCCAGTGCCTGGGG 0: 1
1: 0
2: 0
3: 41
4: 362
948569147_948569152 -10 Left 948569147 2:238906698-238906720 CCTCCAGCTTCCACATCCTCCCC 0: 1
1: 0
2: 9
3: 101
4: 915
Right 948569152 2:238906711-238906733 CATCCTCCCCCCAGTGCCTGGGG 0: 1
1: 0
2: 0
3: 41
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948569152 Original CRISPR CATCCTCCCCCCAGTGCCTG GGG Intronic
900102375 1:967375-967397 CACCCCCCCCCCAGCCCCTGTGG + Intronic
900184983 1:1328713-1328735 CAGCCACCATCCAGTGCCTGGGG + Exonic
900461201 1:2802782-2802804 CACCCTCCCCAAAGGGCCTGCGG - Intergenic
901072222 1:6526767-6526789 CATCCTCACCCCTGTGCCCCCGG - Exonic
901892841 1:12282825-12282847 CTGCCTCCCCTCAGTACCTGTGG + Exonic
902186100 1:14726526-14726548 CATCCTTCCTCGAGTGTCTGTGG + Intronic
902292185 1:15442594-15442616 CACACTGCCCCCAGTGGCTGTGG - Intronic
905178619 1:36153397-36153419 CATCCTCCGCACACTCCCTGTGG + Intronic
905258988 1:36704410-36704432 CATGCTCTCCCCTGTGGCTGGGG + Intergenic
905310836 1:37047667-37047689 CCTCTTCTCCCCACTGCCTGTGG + Intergenic
905629803 1:39512167-39512189 CCTCCTGGCCTCAGTGCCTGAGG - Intronic
905667956 1:39774023-39774045 CCTCCTGGCCTCAGTGCCTGAGG + Intronic
905761088 1:40558887-40558909 CATCCACCACCCAGGGGCTGAGG - Intergenic
906097560 1:43234646-43234668 CATGCTCCCCTCAGCCCCTGTGG + Intronic
906687506 1:47772042-47772064 CTTCCTCCACGCAGTGCCGGTGG - Intronic
906864073 1:49396938-49396960 CATCCCCACCCCACTGTCTGCGG - Intronic
907386305 1:54127771-54127793 CCCCCTCCTCCCTGTGCCTGAGG + Intergenic
907476832 1:54711380-54711402 CATCTTACCAGCAGTGCCTGAGG - Intronic
908801590 1:67886067-67886089 CTTCTTCCCCACAGTGGCTGTGG + Intergenic
911058977 1:93731800-93731822 CATAGTGCCCCAAGTGCCTGGGG + Intronic
912435883 1:109660694-109660716 CATCCTCCCCCAAATCCCTCAGG - Intronic
912754659 1:112314164-112314186 CAACCTCCCCTCAGGGTCTGGGG + Intergenic
915304623 1:154970373-154970395 CATCCTGCCTCCTCTGCCTGGGG - Exonic
916196931 1:162233287-162233309 CCTCCCCACCCCAATGCCTGTGG + Intronic
916677960 1:167080094-167080116 CACCCTCCTCCCAGTAGCTGTGG + Intronic
917738930 1:177944899-177944921 CCTCCGCCTCCCAGTGCCTCTGG - Intronic
918054011 1:181002857-181002879 GATCCTCCCTCCTGTGGCTGTGG - Intronic
919074294 1:192795209-192795231 CATCCTCCCACCTTAGCCTGTGG - Intergenic
919923264 1:202178665-202178687 CTTCATAGCCCCAGTGCCTGGGG - Intergenic
921922929 1:220689023-220689045 GATCCTCCCACCACAGCCTGTGG + Intergenic
922422364 1:225468432-225468454 CACCCACTCCCCAGTGCCTGTGG - Intergenic
922481428 1:225942052-225942074 CAATCTGCCCCCAGTACCTGTGG - Intergenic
922481640 1:225943431-225943453 CAATCTGCCCCCAGTACCTGTGG + Intergenic
924637357 1:245800786-245800808 AATCCTTCCCCAAGTTCCTGGGG - Intronic
924845301 1:247762597-247762619 CATCCTTACTGCAGTGCCTGTGG - Intergenic
1063461723 10:6219103-6219125 CCTCCACCCCCCACTGCCTGAGG - Intronic
1063658444 10:8014839-8014861 CATCCACCCCCAGATGCCTGTGG + Exonic
1063785979 10:9382944-9382966 CCTCCTACCTCCAGTGCCTGGGG + Intergenic
1064119386 10:12605853-12605875 CAGCCTCTCCCCGGGGCCTGTGG + Intronic
1065811060 10:29444286-29444308 CAGGCTCCTCCCACTGCCTGTGG + Intergenic
1066102758 10:32132535-32132557 CAGGCTCCTCCCACTGCCTGTGG + Intergenic
1066758177 10:38730795-38730817 CCCCCTCCCCCCAGTCCCCGTGG + Intergenic
1066963508 10:42241921-42241943 CCCCCTCCCCCCAGTCCCCGTGG - Intergenic
1067156953 10:43790315-43790337 CCTCCTCCCCCCAGTGGCGACGG + Intergenic
1067523810 10:47026696-47026718 CATCCTCACTCCGGTCCCTGTGG - Intergenic
1068991511 10:63155741-63155763 CATCCTCCCACCTCTGCCTCTGG - Intergenic
1069828044 10:71266225-71266247 CATCCTGCCCCCATTTGCTGGGG - Intronic
1069903755 10:71720363-71720385 CATGCTCCCCACAGTGCGGGTGG + Intronic
1070307185 10:75246570-75246592 CTTCCTGCCCCCAGTGGCTCAGG + Intergenic
1070571610 10:77643936-77643958 CATCCTGTCTCCAGTGCCTCGGG + Intergenic
1070761629 10:79027756-79027778 CCACCTCCCCCTCGTGCCTGTGG + Intergenic
1070814274 10:79313169-79313191 GAGCCTCCCTCCAGTGACTGTGG + Exonic
1071567942 10:86681160-86681182 CTTCCTGCCCCCAGGGCCCGAGG - Intronic
1071726991 10:88208916-88208938 CATCCTCCCTCCCGTGTTTGTGG + Intergenic
1072234916 10:93445604-93445626 CAACCCGCTCCCAGTGCCTGAGG + Intronic
1072460421 10:95613325-95613347 CTGCCTCCCCCCAGTGTCTTTGG - Intronic
1074145813 10:110716317-110716339 CACCCTCACCCCAGAGCCTCAGG + Intronic
1074495984 10:113980596-113980618 CATCCTCCACCCACAGCCAGAGG + Intergenic
1074756709 10:116629154-116629176 CATCCTTCACCCAGTGCCTTGGG - Intronic
1075971421 10:126657316-126657338 CCTCCTCCTCCCAGCCCCTGGGG + Intronic
1076721886 10:132396651-132396673 CTTCCTCGCCGCAGTGCCCGGGG + Intergenic
1077302716 11:1854666-1854688 CATCCTCCCACCTCTCCCTGGGG - Intronic
1077340880 11:2025831-2025853 CCTCCTCCCCACAGTGGCTGTGG + Intergenic
1077902137 11:6498063-6498085 CATCCCCTGCCCAGAGCCTGAGG + Exonic
1078134180 11:8638578-8638600 CCTCCTCCTCCAAGTGCCTGGGG + Intronic
1079104101 11:17559446-17559468 CATCCTCACTCCACGGCCTGGGG + Intronic
1081538757 11:44014924-44014946 CATCCTCAACCCAGGGCCAGTGG + Intergenic
1083624321 11:64064367-64064389 CATCCTCCATCCAATGCCTGTGG - Intronic
1084450297 11:69232867-69232889 CATCCTCCCACCTGGGTCTGGGG - Intergenic
1084484846 11:69442291-69442313 CCTCCTCACACCAGTCCCTGTGG + Intergenic
1084506683 11:69572801-69572823 CATCCACCTCCCAGTTGCTGAGG - Intergenic
1084648544 11:70474659-70474681 CCTCCCCTCCCCAGTGGCTGTGG - Intronic
1085031240 11:73272099-73272121 CATCCTCCCAACAGTCCCTTGGG + Intronic
1085312981 11:75526849-75526871 GATCCTCCCACCTGTGCCTCCGG + Intergenic
1085821226 11:79795787-79795809 CACCCACTCCCCAGTGCCTGTGG + Intergenic
1086060708 11:82696842-82696864 CACCCAGCACCCAGTGCCTGGGG - Intergenic
1086327337 11:85716634-85716656 CTTCATACCCCCAGTGCCTAGGG + Intronic
1088595505 11:111437617-111437639 CATCCTCACCGCCTTGCCTGAGG + Intronic
1088704704 11:112451520-112451542 CATCCTCCATCCATTGCCTTTGG + Intergenic
1090223652 11:125054669-125054691 CATCCTCCCCCCTCAGCCTTGGG - Intergenic
1090872407 11:130760144-130760166 CATCCTCCACACACTTCCTGGGG - Intergenic
1091032302 11:132201584-132201606 CATCCTCTCCTCAGAGCCAGGGG - Intronic
1091237800 11:134033425-134033447 CAGGCTCCCCACTGTGCCTGGGG + Intergenic
1091322101 11:134658871-134658893 CATCCTCCACTCAAAGCCTGGGG - Intergenic
1202823865 11_KI270721v1_random:81020-81042 CCTCCTCCCCACAGTGGCTGTGG + Intergenic
1092282347 12:7108063-7108085 CAGCCTCCCACCAGCGCCTCCGG - Intronic
1096073834 12:48789727-48789749 CCTCTTCCCCCCAGTCTCTGGGG + Intergenic
1096790858 12:54044014-54044036 CATCCTCCACCCAGGGGATGGGG - Intronic
1097264074 12:57736063-57736085 CATCCTTTCCCCCGGGCCTGTGG - Intronic
1102723021 12:115034295-115034317 CAGCGTCCCCCCACTACCTGCGG + Intergenic
1103226951 12:119295944-119295966 CCTGCTCCCCCCAGGGACTGTGG - Intergenic
1103722295 12:122981307-122981329 CCTCCTCTCCCCGATGCCTGTGG - Exonic
1103852064 12:123939888-123939910 TGTCCTTCCCCCAGGGCCTGTGG + Intronic
1105266663 13:18824907-18824929 CCCCATCCCCCCAGTGCATGTGG - Intergenic
1107164126 13:37265480-37265502 CATGCTCCCTCCACAGCCTGTGG + Intergenic
1108667997 13:52652145-52652167 CTTCCTCCCCTCAGTACCTTCGG + Intergenic
1110295010 13:73854247-73854269 CAATCTCACTCCAGTGCCTGAGG + Intronic
1110524671 13:76522178-76522200 CCCCATTCCCCCAGTGCCTGTGG + Intergenic
1112065316 13:95786506-95786528 GATACACCTCCCAGTGCCTGTGG + Intronic
1112942048 13:104875216-104875238 CTTTCTCCCCCCAGCTCCTGTGG - Intergenic
1113056621 13:106275025-106275047 CATCTTCCACCCAGGGCCTTGGG + Intergenic
1113552188 13:111201139-111201161 CATCGTCCCCCTTGTTCCTGTGG + Intronic
1113768252 13:112894106-112894128 CCTCCTCCCCGCCGTGCCCGAGG - Intergenic
1115765325 14:36617446-36617468 CACCCTCACCCCAGTGCCTCTGG + Intergenic
1120558559 14:85960849-85960871 CATAGTCCCCCTAGAGCCTGGGG + Intergenic
1120881199 14:89416731-89416753 GACCCTCCCCCCAGGACCTGCGG + Intronic
1121510148 14:94506169-94506191 CAGCCTCCGACCAGTGCCTTAGG - Intronic
1122544163 14:102513082-102513104 CAGCCTCCCCCTACTGCCTGTGG - Intergenic
1123162645 14:106294079-106294101 GATCATCCCCCCTCTGCCTGTGG + Intergenic
1123441580 15:20295509-20295531 CCCCCTCCCCCCAGTCCCCGTGG + Intergenic
1124886631 15:33693410-33693432 CCTCCTACGCCCTGTGCCTGGGG + Intronic
1126343450 15:47668731-47668753 CATCCTCCCCCTTGTACCTGGGG + Intronic
1127698640 15:61475559-61475581 CTTCCTCCCACAAGTACCTGTGG + Intergenic
1128830131 15:70761257-70761279 CACCCTGCCCCCACTTCCTGAGG - Intronic
1132525962 16:414868-414890 CATCCCTCCCTCAGAGCCTGTGG - Intergenic
1132615464 16:839354-839376 CGTCCTCGCCCCAGAACCTGTGG - Intergenic
1132682425 16:1148525-1148547 CCTCTTCCGCGCAGTGCCTGGGG + Intergenic
1133025841 16:2988633-2988655 CTTCCTGACCCCAGTGCCAGAGG - Intergenic
1133642142 16:7727236-7727258 CATGCTCCCACCAGAGGCTGGGG - Intergenic
1134073676 16:11276036-11276058 CCGCCTCCCTCCTGTGCCTGGGG + Intronic
1134134409 16:11669378-11669400 CCTCCTCTCCCGCGTGCCTGAGG - Intronic
1134245744 16:12538673-12538695 CATCCTCCTCCCAGGACCAGTGG + Intronic
1134446213 16:14333336-14333358 CATTTTCCCCCCATTGCCTTAGG + Intergenic
1134565438 16:15247819-15247841 CATCCTCCTCCCTGCCCCTGCGG + Intergenic
1134737058 16:16508879-16508901 CATCCTCCTCCCTGCCCCTGCGG - Intergenic
1134930462 16:18203285-18203307 CATCCTCCTCCCTGCCCCTGCGG + Intergenic
1135200042 16:20429571-20429593 CATCTACCCTCTAGTGCCTGTGG + Intronic
1135852099 16:25973066-25973088 CATCCATCCCCCAGTGCATAGGG - Intronic
1136379757 16:29887755-29887777 CATCGTGTCCCCAGAGCCTGGGG - Exonic
1136506955 16:30710558-30710580 AATCCTGGCCCCACTGCCTGGGG - Intronic
1136578889 16:31140407-31140429 TCTCCTCTCCCCAGTCCCTGTGG - Exonic
1136724656 16:32348401-32348423 CCCCCTCCCCCCAGTCCCCGTGG - Intergenic
1136842983 16:33554441-33554463 CCCCCTCCCCCCAGTCCCCGTGG - Intergenic
1137699936 16:50490213-50490235 CATCCTCCCTCCAGTGCCCATGG - Intergenic
1138266544 16:55663914-55663936 ATTCCTTCCCCCAGGGCCTGGGG - Intronic
1139633206 16:68243194-68243216 CATCCTGCCCCTAATGGCTGTGG + Intergenic
1139673343 16:68506588-68506610 CCTCCTTCCCACAGTCCCTGGGG - Intergenic
1139910039 16:70392092-70392114 CACCCTGCCTCCAGCGCCTGTGG + Intronic
1140471062 16:75214960-75214982 CTCTCTCCCCTCAGTGCCTGTGG + Intergenic
1141907991 16:87040386-87040408 CCTGCTCCCAGCAGTGCCTGTGG - Intergenic
1142175244 16:88642274-88642296 AAGCCTCACCCCAGTGCCTCCGG - Intergenic
1142263370 16:89052646-89052668 CTTCCTCCTCCCCGTGCCTCCGG + Intergenic
1203001774 16_KI270728v1_random:169354-169376 CCCCCTCCCCCCAGTCCCCGTGG + Intergenic
1203133377 16_KI270728v1_random:1705760-1705782 CCCCCTCCCCCCAGTCCCCGTGG + Intergenic
1203153148 16_KI270728v1_random:1854739-1854761 CCCCCTCCCCCCAGTCCCCGTGG - Intergenic
1142581895 17:948497-948519 CAGCCGTCCCTCAGTGCCTGTGG - Intronic
1142632243 17:1232552-1232574 CATCCTCCCTCCTCAGCCTGCGG + Intergenic
1143116013 17:4582262-4582284 CAACCTCCCACCAAGGCCTGGGG - Intergenic
1143134446 17:4703820-4703842 CATCCTCCCCACAGGGCCGCGGG + Intronic
1146436476 17:32853511-32853533 CATCCTCCTCTGAGTTCCTGGGG + Intronic
1146667278 17:34713474-34713496 CACCCTCCACCCACTGGCTGGGG + Intergenic
1147452123 17:40512241-40512263 CACCCTCCCACCAGTGAGTGGGG - Intergenic
1148049247 17:44761014-44761036 CACCCCACCCCCAGTGACTGCGG - Intronic
1148444321 17:47728286-47728308 CAGCCTCCACTCAGGGCCTGGGG - Intergenic
1151272096 17:73004757-73004779 CATCTTTGCCCCATTGCCTGTGG - Intronic
1151601764 17:75110247-75110269 CACCCTCCCGCCCGTCCCTGGGG + Exonic
1151750956 17:76037288-76037310 CATCCTCCTCCCAGGGCCATGGG - Intergenic
1152746770 17:82043964-82043986 CAGCCTGCCCCCAGAGCCTTTGG + Intergenic
1152778994 17:82218212-82218234 CGTCCACCCCCCAGTGACTGAGG - Intergenic
1152790133 17:82274200-82274222 CTGCCTCCCTCCAGTCCCTGCGG + Intergenic
1154421750 18:14236564-14236586 CCTCATCCCCCCAGTGCATGTGG + Intergenic
1155495192 18:26435897-26435919 GCTCCTCCCTGCAGTGCCTGTGG + Intergenic
1158038857 18:53068883-53068905 AAACCTGCCCCCAGTGTCTGAGG + Intronic
1159244932 18:65793325-65793347 AATCCTCCCACCACAGCCTGTGG - Intronic
1159818114 18:73102759-73102781 TATCCTGCCCTCAGTTCCTGGGG - Intergenic
1160912846 19:1482831-1482853 CAACCTCCCCCCAGGGGCTCTGG - Intronic
1160930912 19:1568951-1568973 CATGCACACCCCAGGGCCTGAGG + Intergenic
1161713729 19:5864030-5864052 CACCCTCCCACCTGGGCCTGGGG + Intergenic
1161864930 19:6826752-6826774 CCTGCTGCCCCCAGGGCCTGGGG - Intronic
1161999137 19:7732004-7732026 CATCCCTGCCCCAGTGTCTGGGG - Intronic
1162973601 19:14195667-14195689 CATAGTCACCCCAGGGCCTGCGG - Intronic
1163142646 19:15360819-15360841 CTTCCTCCCCACACTGCCTGGGG - Intronic
1163601853 19:18254064-18254086 CGTCATCCCCACAGGGCCTGGGG - Intronic
1164914102 19:32036682-32036704 CATCTTCACACCAGTGTCTGAGG + Intergenic
1165175679 19:33928065-33928087 CATCCTCCTGCCAGGGCCTTCGG + Intergenic
1165755643 19:38291215-38291237 CAGCCTCCCCCATGTGGCTGTGG - Intronic
1166098070 19:40554133-40554155 CCTCCTGCCCCCAGGGCCTGCGG + Exonic
1166219051 19:41353684-41353706 CCTCCTCCCCGCAGTGGCGGGGG + Exonic
1166232156 19:41431110-41431132 CATAATCCCACAAGTGCCTGTGG - Intronic
1166340397 19:42133519-42133541 CATCCTGCGCCCCGTGGCTGGGG + Intronic
1166420931 19:42635321-42635343 CAGCCTCTCCCCAGTGACTTGGG - Intronic
1166733490 19:45071368-45071390 CGGCCAGCCCCCAGTGCCTGGGG - Intergenic
1166967047 19:46535287-46535309 AATCCTCGCCCCAGACCCTGAGG - Intronic
1168671492 19:58244330-58244352 CATCCACCCTCAAGGGCCTGAGG - Intronic
925971319 2:9108455-9108477 CTGCCTCTCCCCAGTGCCTCTGG + Intergenic
926217362 2:10913776-10913798 CAACCTCCCTCCAGAGCCTGCGG + Exonic
926685808 2:15696862-15696884 GAGCCTCCCCCCACTGCCTTGGG - Intronic
927467821 2:23350403-23350425 CATCCATCCCCAAGTGCCGGGGG - Intergenic
929531454 2:42755627-42755649 CACCCTTCCTCCATTGCCTGGGG - Exonic
930025919 2:47029096-47029118 CTCCCTGCCCCCAGTGCCTGGGG + Intronic
930722762 2:54653797-54653819 CATCCTCCATCCAGAGCATGAGG - Exonic
930797049 2:55404846-55404868 CAGCCTCCCCCGAGTAGCTGGGG + Intronic
931698126 2:64887440-64887462 CTTCCTTCACCCAGTGTCTGAGG - Intergenic
932644690 2:73488246-73488268 CAACCTCCCTCCTGTGCTTGTGG + Intronic
932675802 2:73779940-73779962 CATCATCCCCGCAGTGGCTGGGG - Exonic
934133271 2:88970165-88970187 CCTCCTCACTCCAGGGCCTGAGG + Intergenic
934234291 2:90216425-90216447 CCTCCTCACTCCAGGGCCTGAGG - Intergenic
934321494 2:91975235-91975257 CCCCCTCCCCCCAGTCCCTGTGG + Intergenic
934496387 2:94804552-94804574 CCCCATCCCCCCAGTGCTTGTGG - Intergenic
934645073 2:96054528-96054550 CATCCTGCCCACCGTGGCTGAGG - Intergenic
934819396 2:97359036-97359058 CAGCCTCCCCCTAGAGCCTCTGG - Intergenic
934838480 2:97610617-97610639 CATCCTGCCCACCGTGGCTGAGG - Intergenic
935594216 2:104867204-104867226 CAATCTCCCCTCCGTGCCTGGGG - Intergenic
936164117 2:110105272-110105294 GAACCTCCCCACACTGCCTGTGG - Intronic
937318212 2:120945409-120945431 CATCCTGCCCACAGTGGCCGAGG - Intronic
937907609 2:127059836-127059858 CACCTTCGCCCCTGTGCCTGGGG - Intronic
937912389 2:127081902-127081924 CTTCCTCCCAGCAGAGCCTGCGG + Intronic
938238104 2:129722728-129722750 TCTCCTCTCCCCAGAGCCTGAGG + Intergenic
938312659 2:130302945-130302967 CCTCCTCCTGCTAGTGCCTGAGG + Intergenic
938548943 2:132361712-132361734 CGTCCTCCCTCCTGCGCCTGAGG + Intergenic
938763756 2:134446816-134446838 CCTCCCTCCCCCAGAGCCTGCGG - Intronic
940882121 2:158957189-158957211 CATCCTCCCTCCAGAGGCTCTGG - Intergenic
942374474 2:175322829-175322851 CAGCCTCCCCCAAGTAACTGGGG + Intergenic
942619687 2:177833945-177833967 CACCATTCCCCCAGTGCATGTGG - Intronic
943947336 2:194084652-194084674 CCTCATCCTCCCAGTGCATGTGG + Intergenic
946149845 2:217756807-217756829 GATCCTGGCCCCAGGGCCTGGGG - Intergenic
947570358 2:231228809-231228831 CTTCCTGCCCCCATTGCCTGGGG - Intronic
948020757 2:234731355-234731377 CATCAGCCCCCGAGTACCTGGGG + Intergenic
948307162 2:236956874-236956896 CATCCATCCACCAGTCCCTGAGG + Intergenic
948569152 2:238906711-238906733 CATCCTCCCCCCAGTGCCTGGGG + Intronic
949007927 2:241660807-241660829 CATCCTCCCTCCCGTGTTTGGGG + Intronic
1171310244 20:24139687-24139709 CATTCTGGCCCCAGTACCTGTGG + Intergenic
1171877768 20:30594273-30594295 CGTCCTCCCTCCAGCGCCTGAGG + Intergenic
1172162132 20:32876066-32876088 CAGCCTCCCTCCAGCACCTGAGG - Intronic
1172966656 20:38840311-38840333 CAACCTCCCCCACCTGCCTGGGG + Intronic
1173730561 20:45325502-45325524 CCTCCTGACCCCAGTGGCTGCGG - Exonic
1173828577 20:46063285-46063307 CACCCTCCCAACAGAGCCTGGGG + Intronic
1175527573 20:59646103-59646125 CAGCCTCCAGCCAGTCCCTGGGG + Intronic
1175725793 20:61317564-61317586 CATCCAGCCCCCCATGCCTGTGG - Intronic
1175739760 20:61412407-61412429 CCTCCTCCCCAGAGTGCCGGAGG + Intronic
1175825783 20:61936038-61936060 CGTCCTCTCCTCAGTGCCCGCGG - Intronic
1176428139 21:6561150-6561172 CACCCTCTCCCCAGTGCCAGGGG - Intergenic
1176851732 21:13923396-13923418 CCCCATCCCCCCAGTGCATGTGG - Intergenic
1177773219 21:25539814-25539836 CACCCTCCCACCAGGGGCTGAGG + Intergenic
1178254937 21:31043899-31043921 CACCATACTCCCAGTGCCTGGGG + Intergenic
1178842712 21:36150756-36150778 CATCTCACCCCCTGTGCCTGAGG + Intergenic
1179120848 21:38544283-38544305 CAGCCTTCCTCCAGGGCCTGAGG - Intronic
1179655323 21:42841365-42841387 AATCCTCCCCCCAGGACCTTGGG - Intergenic
1179703630 21:43169467-43169489 CACCCTCTCCCCAGTGCCAGGGG - Intronic
1179935315 21:44600229-44600251 CATCCTAATCCCAGCGCCTGTGG - Intronic
1180095234 21:45553325-45553347 CATCCTCCCTCCAGCCCATGAGG + Intergenic
1180309746 22:11159194-11159216 CCCCCTCCCCCCAGTCCCCGTGG + Intergenic
1180548223 22:16521004-16521026 CCCCCTCCCCCCAGTCCCCGTGG + Intergenic
1180620465 22:17158706-17158728 GCTCCGCCCCCAAGTGCCTGTGG - Intronic
1180945301 22:19689186-19689208 CCTCGTCCCCCCAGTGCAGGGGG + Intergenic
1181160846 22:20958618-20958640 CATCCTCCCACCTCAGCCTGTGG - Intergenic
1181772872 22:25139355-25139377 CAGCCTCCCTCCACTTCCTGAGG - Intronic
1181824377 22:25502599-25502621 CATCCTCCCACCTGAGCCTCTGG + Intergenic
1182076770 22:27500218-27500240 CAGCCTCCGCTCAGTGCCTCTGG - Intergenic
1183366150 22:37408115-37408137 CATGATCCCCCCAGGGGCTGCGG + Intronic
1183597330 22:38820569-38820591 CCTCCTCCCCGCACTTCCTGGGG + Exonic
1184264938 22:43341963-43341985 CATCATCCCCCTTGTGTCTGTGG - Intronic
1184325192 22:43777626-43777648 CCTCCTGCCCCCAGTGTCAGAGG + Intronic
1184347436 22:43922420-43922442 CTTGCTCCACCCAGTGCCAGGGG + Intergenic
1184452512 22:44591459-44591481 CATACTCCCTCCCGGGCCTGCGG + Intergenic
1184457280 22:44618436-44618458 CATCCTCCCCCCAGCACCCTGGG + Intergenic
1184691005 22:46117230-46117252 CAGCCTCCCCCCAGGCTCTGGGG - Intergenic
1184730202 22:46367530-46367552 CCTCCTCCCCACTGTGTCTGGGG - Intronic
1184806379 22:46797140-46797162 CAGGCTCCCACCAGTGCCTGGGG - Intronic
1185088453 22:48753130-48753152 CCTCCTTCCCTCAGTGCATGGGG - Intronic
949873210 3:8606826-8606848 CATCCTGCCCCCTGTGCCAGAGG + Intergenic
949944410 3:9178737-9178759 CCTCCTCCTCCCAGTCCCTAGGG + Intronic
949961306 3:9314676-9314698 CCTCCTCTCCCCAGTGCTGGAGG + Intronic
950046613 3:9952059-9952081 CGGCCTCTCCCCAGTCCCTGCGG - Intronic
954215479 3:49122069-49122091 CATCCTCAGCCCAGCTCCTGGGG + Exonic
956229558 3:66998435-66998457 CGTCCTCATCCCACTGCCTGTGG - Intronic
959849698 3:111071936-111071958 CAGCCTCCGCCCAGAGCCTGAGG + Exonic
960940404 3:122929408-122929430 CATTCCCCACCCAGGGCCTGGGG - Intronic
961404395 3:126668062-126668084 GGTCCTGTCCCCAGTGCCTGGGG + Intergenic
961509457 3:127392074-127392096 CATCCTCCCTCCTGTTTCTGGGG + Intergenic
961830602 3:129621214-129621236 CATCCTCCCCAAGGGGCCTGGGG - Intergenic
962697241 3:137962418-137962440 CTTCCTCCCACCAGTCCTTGGGG + Intergenic
967924731 3:194637264-194637286 CATCCTCCCACCAGGCCCTGGGG + Intergenic
967948060 3:194819642-194819664 CATCCTCCCACCCCTTCCTGGGG - Intergenic
968135414 3:196216668-196216690 CTTCCTCACCCCGGTGCCTGCGG + Exonic
968135989 3:196219982-196220004 AATCCTCCCCACTCTGCCTGCGG - Intronic
968523518 4:1045201-1045223 CATCCTCACCCTGGTGCCTGTGG + Intergenic
968656563 4:1780881-1780903 CAGCCTCCCCTCATTCCCTGGGG + Intergenic
968746003 4:2360541-2360563 CATGGTCCCAGCAGTGCCTGGGG + Intronic
969090678 4:4691862-4691884 CATTCTCCCAGCAGTGCCTCAGG + Intergenic
969096568 4:4736910-4736932 CATCCTACCCAGAGTGCATGGGG + Intergenic
969195683 4:5562006-5562028 CATCCACACAGCAGTGCCTGAGG - Intronic
969526973 4:7708812-7708834 CATCCTCCCACCACTCCCTCAGG - Intronic
970084602 4:12332726-12332748 CATTCTCCCCTCAGGGCCTTTGG + Intergenic
970402066 4:15726783-15726805 CATCCTAGCACCAGTGCCTTGGG + Intronic
970942735 4:21654569-21654591 CATCATCACCCAAGTACCTGGGG + Intronic
971025477 4:22585092-22585114 CATCCTCCACCCATGTCCTGGGG + Intergenic
972630148 4:40835568-40835590 GAGCCTCACCACAGTGCCTGGGG - Intronic
973340410 4:48997624-48997646 CAGCCTCATCCCAGAGCCTGAGG + Intronic
974785749 4:66618490-66618512 CACCCTGCCCCCACTACCTGGGG - Intergenic
976206512 4:82627610-82627632 AAGCCTCATCCCAGTGCCTGGGG - Intergenic
978943149 4:114461763-114461785 CTTCCTCCCACCCATGCCTGGGG + Intergenic
986299221 5:6465555-6465577 TTTCCACTCCCCAGTGCCTGGGG + Intronic
996044393 5:118853724-118853746 CCTCCTCCCCTCTGTGTCTGTGG - Intronic
997399503 5:133591537-133591559 CATCCTCCCCTCAGAGCCCCTGG + Intronic
997795793 5:136809487-136809509 CTACCTCCCCTCAATGCCTGTGG + Intergenic
999814867 5:155165890-155165912 CATCCTCTGCCCAGTGCCAGCGG - Intergenic
1000907209 5:166977930-166977952 CATCCTGTCTCCAGTGACTGAGG + Intergenic
1002556482 5:180045958-180045980 CATCCACCGCCCAGGGGCTGAGG - Intronic
1002793979 6:456116-456138 CAACCTCCACACAGTGACTGTGG + Intergenic
1004613645 6:17269213-17269235 CATCACCCCCCCAGTGACTCTGG + Intergenic
1006037211 6:31223101-31223123 AAGCTTCCCACCAGTGCCTGTGG + Intergenic
1006155168 6:32009831-32009853 TCTCCTCCCCGCAGTCCCTGGGG + Intergenic
1006161474 6:32042565-32042587 TCTCCTCCCCGCAGTCCCTGGGG + Exonic
1006501019 6:34458823-34458845 CTTCCTTCCCCCAGGGTCTGGGG + Intergenic
1008036383 6:46749461-46749483 CACCCTGCCCCCCTTGCCTGGGG - Intronic
1008578350 6:52882568-52882590 TATCATCCACCCAGTGTCTGAGG - Intronic
1010945021 6:81963879-81963901 GATCCTCCACCCAATGCCTTAGG + Intergenic
1011618248 6:89217809-89217831 CTTCCTGCCCCCACTTCCTGTGG + Intronic
1011941843 6:92852070-92852092 CTTCCTCCCCCCAAAACCTGTGG - Intergenic
1012520593 6:100116641-100116663 CCACCTCACCCCAGTGCCTGTGG + Intergenic
1014290468 6:119552176-119552198 CTTCCTCCCCCAAGTTCCTCAGG - Intergenic
1015853854 6:137602954-137602976 CATCCTCCCCCAAGATCCTGTGG - Intergenic
1016104670 6:140148124-140148146 CATCCACCGCCCAATGGCTGAGG - Intergenic
1018561711 6:165106810-165106832 CATCCTCCCCCAACTTCCTCCGG - Intergenic
1019386717 7:761234-761256 CACCCTACCTCCAGCGCCTGGGG + Intronic
1019576935 7:1742154-1742176 AAGCCTCCTCCCTGTGCCTGTGG + Intronic
1021355648 7:19650956-19650978 CGTGCTCCACCCAGGGCCTGAGG - Intergenic
1023482464 7:40648677-40648699 CATCTTCCACACAGTGTCTGTGG - Intronic
1023642824 7:42277876-42277898 ATTCCAGCCCCCAGTGCCTGTGG - Intergenic
1024983331 7:55175482-55175504 CATCTTCCCACCACTGGCTGGGG - Intronic
1025209844 7:57014189-57014211 CATCCCCACCTCAGTGCCTGCGG - Intergenic
1025211150 7:57020257-57020279 CATCACGCCCGCAGTGCCTGGGG + Intergenic
1025660805 7:63556590-63556612 CATCACGCCCGCAGTGCCTGGGG - Intergenic
1025662107 7:63562662-63562684 CATCCCCACCTCAGTGCCTGCGG + Intergenic
1027050847 7:75020190-75020212 CATAGTCCCCCCAGACCCTGGGG - Intronic
1029459556 7:100687132-100687154 CTTCCTCCCTCCACTGCCTCAGG - Intronic
1030056570 7:105588506-105588528 CATCCTCCTCCCCAGGCCTGTGG - Intronic
1032475271 7:132207539-132207561 CCTCCTCCCACCAGCTCCTGGGG + Intronic
1032736411 7:134696462-134696484 CATGCCCTGCCCAGTGCCTGAGG - Intergenic
1033659749 7:143395239-143395261 CATCCTCCCTCCACTTCCAGTGG + Intronic
1035020617 7:155797946-155797968 AATCTTCCCTCCTGTGCCTGGGG - Intergenic
1035245321 7:157559281-157559303 CATCCTCCGTCCAGACCCTGAGG - Intronic
1035456549 7:159013156-159013178 CCTCCTCCCAGCAGAGCCTGGGG - Intergenic
1035657193 8:1319148-1319170 CTGCCTCCCTGCAGTGCCTGGGG + Intergenic
1035781080 8:2228934-2228956 CGGCCTCACCCCCGTGCCTGAGG + Intergenic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1036815779 8:11902048-11902070 CATCCTCCCACCTGAGCCTCGGG + Intergenic
1037811558 8:22089653-22089675 CCGCCTCCCCCCAGTCCCGGTGG + Intronic
1038032901 8:23660464-23660486 CACTCTCCTCCCAGAGCCTGAGG + Intergenic
1038417336 8:27406725-27406747 CCTCCTGCCCCAAGTGCCAGTGG + Intronic
1038481079 8:27902224-27902246 CAGCCTCCCCTCAGGGACTGAGG - Intronic
1039081463 8:33738141-33738163 CAGCCTCCCGTCAGAGCCTGAGG + Intergenic
1039579982 8:38657638-38657660 CATCCTCCTAGCAGTCCCTGTGG + Intergenic
1039608246 8:38900503-38900525 CTTCCTGCCCCCAGAGCATGAGG - Intergenic
1041728114 8:61037289-61037311 CCTCCTCCCCACAGCTCCTGGGG + Intergenic
1041738869 8:61138542-61138564 CATCCTCCCCTCCGTGCTAGAGG - Intronic
1041914838 8:63128284-63128306 AATCTTGCGCCCAGTGCCTGAGG - Intergenic
1042189450 8:66170679-66170701 CATTCTCCCAGCAGTGCATGAGG - Intronic
1042994161 8:74675541-74675563 CATCCTCTGCACAGTGCCTGTGG - Intronic
1044170864 8:89050107-89050129 TATGCTCCCCCCTGAGCCTGAGG + Intergenic
1044819544 8:96146134-96146156 CTTGCTCCCCTCAGTGCCTAGGG + Intronic
1045491346 8:102671451-102671473 CTTCCTCCGCCCATTGCCTGTGG + Intergenic
1047530277 8:125667910-125667932 CATGCTTCCCGCACTGCCTGAGG + Intergenic
1048510477 8:135057359-135057381 CATCCTTCCCACGGTGCGTGAGG - Intergenic
1049023445 8:139973012-139973034 CCTCCTCCCCCTAGTCCATGGGG - Intronic
1049353510 8:142176713-142176735 CATTCTACCCACAGTCCCTGTGG + Intergenic
1049553282 8:143270462-143270484 CAGCCTCCTCGCAGTCCCTGGGG - Intronic
1049614663 8:143570869-143570891 CCACCTACCGCCAGTGCCTGGGG + Exonic
1049992062 9:999827-999849 CATCATCCCCACAGGGCTTGGGG + Intergenic
1051553857 9:18360579-18360601 CAGCCTCCCCTCAGTCACTGGGG - Intergenic
1053500357 9:38583984-38584006 CCCCATCCCCCCAGTGCATGTGG - Intergenic
1053660755 9:40275895-40275917 CCCCATCCCCCCAGTGCTTGTGG + Intronic
1053751955 9:41266198-41266220 CGTCCTCCCTCCTGCGCCTGAGG - Intergenic
1053911133 9:42905240-42905262 CCCCATCCCCCCAGTGCTTGTGG + Intergenic
1054257478 9:62830528-62830550 CGTCCTCCCTCCTGCGCCTGAGG - Intergenic
1054523855 9:66100389-66100411 CCCCATCCCCCCAGTGCTTGTGG - Intergenic
1054680507 9:67911888-67911910 CCCCATCCCCCCAGTGCTTGTGG + Intergenic
1054915032 9:70487812-70487834 AATCCTTCCCACAGAGCCTGGGG + Intergenic
1056172279 9:83997543-83997565 CACCCTCCTCCCAGTGGGTGCGG - Intronic
1056690709 9:88806621-88806643 CAGCCTCCACCCAGTGCCACTGG + Intergenic
1056735989 9:89209715-89209737 CATCCACCACCCAATGGCTGAGG + Intergenic
1057052502 9:91936198-91936220 CATCCACCCATAAGTGCCTGTGG - Intronic
1057519797 9:95751820-95751842 CATCCTCCCTCCTGTGGCTCAGG - Intergenic
1059240012 9:112796406-112796428 CGTCCACACCCCAGTGTCTGGGG - Intronic
1059671857 9:116499574-116499596 CATAATCCTCCCAGTGCATGAGG - Intronic
1060059264 9:120444462-120444484 TCTCCTACCCCCAGTGCATGAGG + Intronic
1061118538 9:128629332-128629354 CCTCCTGCCCCCAGGTCCTGGGG + Intronic
1061203005 9:129148061-129148083 CACCCTGCCCCCTGGGCCTGAGG + Exonic
1061522235 9:131125601-131125623 CTTCCTCCCCTCAGCGCCAGCGG - Exonic
1061790590 9:133057023-133057045 CCTCCTCCCACCAGGGCCAGGGG - Intronic
1061796264 9:133087468-133087490 CATCAACGCCCCAGAGCCTGGGG - Intergenic
1061820958 9:133226945-133226967 CATCCTCCTCCATGGGCCTGTGG - Intergenic
1062099689 9:134721633-134721655 CCTCCTCCGCCCAGTCCTTGTGG + Intronic
1062239461 9:135527864-135527886 CATCCTCCCCACTATGCCTCGGG + Intergenic
1062239471 9:135527913-135527935 CATCCTCCCCACTATGCCTCGGG + Intergenic
1062239481 9:135527962-135527984 CGTCCTCCCCACTGTGCCTCGGG + Intergenic
1062247381 9:135576156-135576178 TCTCCTCCCCCCGGGGCCTGAGG + Intergenic
1062279953 9:135747403-135747425 CCTCCTCCCCTCACTGCCGGCGG - Intronic
1062286141 9:135773376-135773398 CATCCTCCACCCAGTGCCCTAGG + Intronic
1062395946 9:136352833-136352855 CCTCCCCCTCCCCGTGCCTGTGG - Intronic
1062482686 9:136759686-136759708 CATCCTCCACCCCCCGCCTGTGG - Exonic
1187167511 X:16818147-16818169 CATGCTCCCCCAAGTTCCTGTGG - Intronic
1189943017 X:46146535-46146557 CATCCTCCCCGCTCTGCCTCTGG + Intergenic
1194081584 X:89473196-89473218 CATCCTCCCCCATTTGCATGGGG - Intergenic
1195680943 X:107546019-107546041 CCTTCTCCCCACAATGCCTGGGG - Intronic
1197307535 X:124862395-124862417 CCCCCTCCCCCCATTGCCCGTGG + Intronic
1198522205 X:137464491-137464513 CAACCTCTCCCCAGCCCCTGAGG - Intergenic
1199112293 X:143949163-143949185 CTTCCTCTCTCCAGTGCCTGAGG - Intergenic
1199700544 X:150372338-150372360 CAACCTCCCACCATTGCCAGAGG - Intronic
1199831225 X:151551191-151551213 CATCCACCCCCCAAGGGCTGAGG - Intergenic
1199863380 X:151821757-151821779 CCTCCTCCCCTCAGGGCCTTGGG - Intergenic
1200772610 Y:7141023-7141045 AATCCTCCACCCCGAGCCTGCGG + Intergenic
1201232589 Y:11879563-11879585 CATCCACCCCCCAAGGGCTGAGG - Intergenic