ID: 948569809

View in Genome Browser
Species Human (GRCh38)
Location 2:238910839-238910861
Sequence CACGCTTCTGTATCAAGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948569809_948569814 14 Left 948569809 2:238910839-238910861 CCCGCTCTTGATACAGAAGCGTG 0: 1
1: 0
2: 0
3: 8
4: 56
Right 948569814 2:238910876-238910898 CACCCCTGCTGTCCAAAGTCCGG 0: 1
1: 0
2: 2
3: 13
4: 276
948569809_948569815 15 Left 948569809 2:238910839-238910861 CCCGCTCTTGATACAGAAGCGTG 0: 1
1: 0
2: 0
3: 8
4: 56
Right 948569815 2:238910877-238910899 ACCCCTGCTGTCCAAAGTCCGGG 0: 1
1: 0
2: 1
3: 31
4: 872

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948569809 Original CRISPR CACGCTTCTGTATCAAGAGC GGG (reversed) Intergenic
900380805 1:2382903-2382925 CAGGATGCTGTTTCAAGAGCAGG + Intronic
902452780 1:16508503-16508525 CACTCTTCTGTTTCTAAAGCAGG - Intergenic
902472840 1:16661174-16661196 CACTCTTCTGTTTCTAAAGCAGG - Intergenic
902485963 1:16746269-16746291 CACTCTTCTGTTTCTAAAGCAGG + Intronic
902499705 1:16901720-16901742 CACTCTTCTGTTTCTAAAGCAGG + Intronic
915276587 1:154793000-154793022 CTCGGTTCTGTACCAAGAGCAGG + Intronic
919075686 1:192809741-192809763 CACGCTTCTCTCTTTAGAGCAGG - Intronic
1064224204 10:13468317-13468339 CAGGCTTGTCTATAAAGAGCGGG + Intronic
1065353461 10:24816271-24816293 CACATTTCTGTACCAAGAGCCGG + Intergenic
1072797596 10:98367865-98367887 CACGCTGCCGTAACAAGAGCGGG + Intergenic
1075603230 10:123786295-123786317 CACGCTTCTGTAGACAGAGACGG + Intronic
1079098839 11:17528279-17528301 CACGGCTCTGTATCCAGGGCTGG - Intronic
1081937958 11:46918024-46918046 CTCGCTGCTCTTTCAAGAGCGGG - Intronic
1093656061 12:21695142-21695164 CCCACTTCCGTATCAATAGCAGG + Intronic
1100130060 12:91481084-91481106 CATACTTCTGAATAAAGAGCAGG - Intergenic
1103906284 12:124328819-124328841 CACGTTTCTGTAGCAACTGCTGG + Intronic
1109404897 13:61885251-61885273 CACGGCTCTGTAGCAAGATCAGG + Intergenic
1110669593 13:78161716-78161738 CACACTTCTGGATAAAAAGCAGG - Intergenic
1114456833 14:22860618-22860640 CACACTTCTGCAGCAAAAGCAGG + Intergenic
1116477558 14:45359193-45359215 CACCTTTCTGTGTAAAGAGCTGG - Intergenic
1134891125 16:17842642-17842664 TATGCTTCTGTATTGAGAGCAGG - Intergenic
1139532714 16:67550723-67550745 CAGGCTCCTGTGACAAGAGCAGG - Intergenic
1142695725 17:1632024-1632046 CTTGCTTCTCTATCAAGGGCTGG - Intergenic
1142738226 17:1915155-1915177 GACGCTTCTGTCTAAAAAGCAGG - Intergenic
1144164069 17:12590565-12590587 CACTCTTCTGTATGACGAGCTGG - Intergenic
1148998386 17:51732412-51732434 CATGCTTCTCTTTCAAGATCCGG + Intronic
1150634700 17:66904757-66904779 CAAGCTTCTGAATGCAGAGCAGG + Intergenic
1151686029 17:75647156-75647178 CTGGCTCCTGTATCTAGAGCGGG + Intronic
1152283957 17:79401801-79401823 CAAGCTGCTGTATCTGGAGCCGG - Intronic
1154069115 18:11137108-11137130 CATGATTCTGTATTAGGAGCAGG + Intronic
1154166658 18:12020120-12020142 CACGCTTCGGCCTCAAGTGCTGG + Intronic
1160751064 19:734855-734877 TCCGCTTCTGTATCGATAGCGGG + Intronic
1162440603 19:10689913-10689935 CACGCTGCTTTCCCAAGAGCAGG - Exonic
927560955 2:24072895-24072917 TACCATTCTGTATCTAGAGCAGG + Intronic
930548207 2:52797137-52797159 CAAGCTACTGCATCAAGAACTGG + Intergenic
948569809 2:238910839-238910861 CACGCTTCTGTATCAAGAGCGGG - Intergenic
1174801794 20:53570076-53570098 CATGCTCCTGTATCTGGAGCTGG - Intronic
1176407825 21:6431034-6431056 CACACATCTGTATCTGGAGCGGG - Intergenic
1179683316 21:43039365-43039387 CACACATCTGTATCTGGAGCGGG - Intergenic
1183870673 22:40739608-40739630 CATGCTTTTGTAACAAGGGCCGG + Intergenic
950177061 3:10882236-10882258 CCCACTTCTGCATAAAGAGCAGG - Intronic
976807497 4:89064473-89064495 TATGCTTCTGTAACAATAGCTGG + Intronic
978405060 4:108370565-108370587 CACGCTGCTTTACAAAGAGCAGG + Intergenic
990495290 5:56341483-56341505 CCAGCTTCTGTATCAAGAACAGG + Intergenic
990618959 5:57539350-57539372 GACACTTCTGCATCAAGACCAGG - Intergenic
991956184 5:71997945-71997967 CACCCATCTCTATTAAGAGCTGG + Intergenic
992326969 5:75669334-75669356 CAAGCAACTGTATGAAGAGCTGG + Exonic
998138357 5:139686177-139686199 CACCGTTCTGTGTCTAGAGCTGG - Intergenic
1007398728 6:41591638-41591660 CAGGCTTCTGTATCAAGCTTGGG - Intronic
1018431129 6:163723609-163723631 CACTCTACTGCATCAGGAGCAGG + Intergenic
1019904380 7:4049539-4049561 CCCTCTTGTGTATCAAGAGCTGG + Intronic
1032416008 7:131736175-131736197 CACCCTTCCGTCTCCAGAGCTGG - Intergenic
1032664025 7:134016929-134016951 CACTCTTCTGAATCAAGAGTGGG + Intronic
1033601423 7:142891681-142891703 CACGCTTCCTTAGCAAGATCTGG + Intergenic
1046182606 8:110671952-110671974 CAAGCTTCTCTATTAAGAGTAGG - Intergenic
1048293584 8:133198455-133198477 CAGGCTTGTGTAGGAAGAGCAGG - Intronic
1049091768 8:140520062-140520084 CACGCTTCTGCCTCGGGAGCTGG + Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1203790647 EBV:149791-149813 CACGCTCCTGCACCCAGAGCGGG - Intergenic
1191006533 X:55716198-55716220 CCCGCTCCTGTATCATAAGCTGG + Intergenic
1192786864 X:74344624-74344646 CATGCTTCTGGACCAAGAGTGGG + Intergenic
1198095301 X:133374233-133374255 TACTCTTTTGTATAAAGAGCAGG - Intronic
1200293153 X:154890580-154890602 TTCCCTTCTGTATCAAGAGTTGG - Intronic
1201775242 Y:17655601-17655623 CAAGCTGCTGAATCAAAAGCAGG + Intergenic
1201826314 Y:18250388-18250410 CAAGCTGCTGAATCAAAAGCAGG - Intergenic