ID: 948570114

View in Genome Browser
Species Human (GRCh38)
Location 2:238912562-238912584
Sequence CCCGGAGAGGCGGCCGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 261}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948570114_948570124 24 Left 948570114 2:238912562-238912584 CCTGCGGCGGCCGCCTCTCCGGG 0: 1
1: 0
2: 3
3: 30
4: 261
Right 948570124 2:238912609-238912631 AGCCCAACTGCTGCACACTCTGG 0: 1
1: 0
2: 0
3: 9
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948570114 Original CRISPR CCCGGAGAGGCGGCCGCCGC AGG (reversed) Intergenic
900091748 1:923865-923887 CCCGGCGCGGCGGGCGGCGCGGG - Intergenic
900283864 1:1890363-1890385 CCCCGATAGGCGGCCCGCGCGGG + Intronic
900578036 1:3393998-3394020 CCTGGAGCCGCCGCCGCCGCGGG - Intronic
900633819 1:3652241-3652263 CCCGGCGAGGCCGCCCACGCAGG - Intronic
900782556 1:4627527-4627549 CCTGCAGAGGCTGCCCCCGCTGG - Intergenic
901151685 1:7107613-7107635 CCCGGAGGGGCGGGTGCTGCTGG + Intronic
901870812 1:12138330-12138352 CCTGGAGAGCCTGCCGCTGCAGG + Exonic
903115596 1:21176484-21176506 CCCGGGGAGGCGGCGGGAGCGGG + Intronic
903663657 1:24994088-24994110 CCCGGAGATGGGGCTGCAGCAGG - Intergenic
904528932 1:31155350-31155372 CCCGGAGAGGGGGAGGGCGCAGG + Intergenic
904783000 1:32964593-32964615 GCCGCAGCGGCGGCCGGCGCCGG - Exonic
905867101 1:41382355-41382377 CCCGGCGAGGCGGGCGCCGCGGG + Exonic
905912141 1:41662341-41662363 CCCGGAGCCGCGCCCGCCGCCGG - Intronic
906960820 1:50418698-50418720 CCCGTACAGGCCGCCGCCGTAGG + Exonic
907430107 1:54406548-54406570 TCCGCGGAGGCGGCCGCAGCGGG - Intronic
908132025 1:61083246-61083268 CCCGGGGAGGGGGCCGCCGACGG + Intronic
910251243 1:85201073-85201095 CCCAGGGAGGAGCCCGCCGCTGG + Intergenic
911188487 1:94926552-94926574 GCCGGAAAGGCTGGCGCCGCGGG + Intronic
911188602 1:94926966-94926988 CCCCGAGGAGTGGCCGCCGCGGG + Exonic
912492705 1:110070720-110070742 CCGGGAGCGGCGCGCGCCGCGGG + Intronic
914125465 1:144813794-144813816 GGCGGAGAGGCGGCCGGCGGCGG - Intergenic
914713407 1:150235173-150235195 CCCGGAGGAGTGGGCGCCGCCGG + Intronic
915070388 1:153261296-153261318 CCCGGAGGAGCCGCCGCCACCGG - Exonic
915070420 1:153261386-153261408 GCCCGAGAAGCCGCCGCCGCCGG - Exonic
915343825 1:155189529-155189551 CCCGGAGAGCAGGCCGGCCCCGG - Intronic
915343844 1:155189589-155189611 CCCGGAGAGCAGGCCGGCCCCGG - Intronic
915344043 1:155190069-155190091 CCCGGAGAGCAGGCCGGCCCCGG - Intronic
915344064 1:155190129-155190151 CCCGGAGAGCAGGCCGGCCCCGG - Intronic
915430202 1:155860279-155860301 CCAGGGGAGGCGGCGGCCTCTGG + Intronic
916651711 1:166839730-166839752 GCCGGGGAGGCGGGCGGCGCCGG + Intronic
919463157 1:197902586-197902608 CCCGGAGGGGCGACCAACGCGGG - Intergenic
919809401 1:201399338-201399360 CCAGGTGAGGCGGCGGCCGGCGG - Exonic
922513147 1:226186476-226186498 CCCGGGGAGGCGGCGGCTGGGGG - Exonic
923171455 1:231421509-231421531 CACGGCGACGCGGCCGCCGCTGG + Exonic
924289723 1:242524714-242524736 CCCGGGGCGGCGGCGGCGGCGGG + Intergenic
924325435 1:242890445-242890467 CCCGGAGAGGCGGCGGCCAGTGG + Intergenic
924436856 1:244049402-244049424 CCCGGAGCCGCGGCCGTCCCGGG - Intronic
924754850 1:246931674-246931696 CCGGGAGACGTGGCCGCCACGGG + Intronic
1063418196 10:5890168-5890190 CCCCGGGAAGCGCCCGCCGCCGG - Intergenic
1063995050 10:11611386-11611408 CCCGCGGAGCCCGCCGCCGCCGG + Intronic
1072169869 10:92848696-92848718 CCGGGCGGGGCGTCCGCCGCCGG + Intronic
1072409070 10:95183876-95183898 CCCGGGGCGGCGGCGGCGGCAGG - Intergenic
1073212703 10:101818033-101818055 CCCGCAGAGGTGGCAGCGGCCGG - Exonic
1073249799 10:102114593-102114615 CCCGGGACAGCGGCCGCCGCGGG - Intronic
1073414325 10:103368461-103368483 CCCGGAGGGTCGGGGGCCGCAGG - Exonic
1073446582 10:103584585-103584607 GCCGCAGCGACGGCCGCCGCAGG - Exonic
1073503923 10:103967350-103967372 CCCAGAGTGGCCGCCGCCCCTGG + Exonic
1074753597 10:116609192-116609214 CCCCGGGAGGCGGCCGCGGCAGG - Intergenic
1074863953 10:117534452-117534474 CGCGGCGCGGTGGCCGCCGCTGG - Intergenic
1075087320 10:119422240-119422262 CCAGGAGTGGCGGCCGCATCTGG - Intronic
1075430237 10:122374539-122374561 CGCGCCGAGGCCGCCGCCGCTGG + Intergenic
1076554215 10:131311557-131311579 AGAGGAGAGGCTGCCGCCGCCGG + Exonic
1076706882 10:132307299-132307321 CCCGGAGACGCCACAGCCGCGGG + Intronic
1077048394 11:555960-555982 CCCGGTGGGGCGGCCGGGGCTGG - Intronic
1077490180 11:2857480-2857502 GCAGGAGAGGCGGCCGCCAGGGG + Intergenic
1078801053 11:14644243-14644265 CGTGGAGCTGCGGCCGCCGCCGG + Exonic
1080496958 11:32829926-32829948 TCCGGGGAGGCGGCCGACGGAGG - Exonic
1083749850 11:64754942-64754964 CCCAGAGAGGGGGCCGGCTCAGG - Intronic
1083890238 11:65592340-65592362 CCCGGGGCGGCGGCGGACGCCGG - Exonic
1084083890 11:66845939-66845961 CCCACAGAGGCGGCCCCTGCTGG + Exonic
1084146144 11:67266408-67266430 CCCGGAGCCGCCGCCGCCTCCGG - Exonic
1085396896 11:76210895-76210917 TCTGGAGCGGCGGGCGCCGCCGG - Intergenic
1088920199 11:114254941-114254963 CCCGGGGAGGCCGCAGCTGCTGG - Intergenic
1089543714 11:119206449-119206471 CCCGGAGCCGCTGCCGCCCCCGG - Exonic
1090332377 11:125942072-125942094 CCTGGAGAGGAGGCAGCTGCAGG + Intergenic
1091718425 12:2795568-2795590 CGGGGCGAGGCGACCGCCGCGGG + Intronic
1092743020 12:11648947-11648969 CTCGGGGATGCGGCGGCCGCGGG - Intergenic
1092843010 12:12561758-12561780 CCGAGAGGAGCGGCCGCCGCGGG - Intronic
1097267761 12:57755626-57755648 GCCGGGGAGGCGGCTGCGGCTGG + Exonic
1098255465 12:68611168-68611190 CGCCGAGGGGCTGCCGCCGCCGG - Intronic
1098369207 12:69739116-69739138 CCAGGAGGGGCGGCCGCGGCAGG + Intronic
1101466785 12:104957914-104957936 CCCGGAGAGGCGTCCGCAGGGGG + Intronic
1102768267 12:115451849-115451871 CAGGGAGAGGCGGGCCCCGCTGG - Intergenic
1104031671 12:125069336-125069358 CACGGAGAGGCGGCCGGAGTGGG - Intronic
1104697108 12:130872039-130872061 GCCGGAGACGCAGCCGACGCCGG - Exonic
1105240892 13:18609245-18609267 CACCGGGAGGCGGCCGGCGCGGG - Intergenic
1110450813 13:75636180-75636202 ACCACAGAGGCGGCCGCGGCCGG + Intronic
1112505081 13:99970583-99970605 CCCGGCGCCGCCGCCGCCGCCGG - Exonic
1113379004 13:109786313-109786335 CCCGAGGAGGCAGCGGCCGCAGG - Exonic
1114270793 14:21098610-21098632 CCGCGAGAGGCGGCCGCCAGGGG + Exonic
1115320741 14:32077122-32077144 CCCGGCGCGGCGGCGGGCGCTGG + Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1122787518 14:104170827-104170849 CCCTGAGAGGGGGCAGACGCCGG - Intronic
1123490465 15:20775894-20775916 CACCGGGAGGCGGCCGGCGCGGG + Intergenic
1123546966 15:21344981-21345003 CACCGGGAGGCGGCCGGCGCGGG + Intergenic
1124971025 15:34489837-34489859 CCAGGAGAGGGGGCTGCCTCTGG + Intergenic
1125508845 15:40282237-40282259 CCCGCAGAGTCGGCCGCCTCGGG + Exonic
1125999349 15:44194865-44194887 CCCTGGGCGGCGGCCGCCGCCGG + Intronic
1128199380 15:65791935-65791957 CCCGGAGAGGTGACAGCCGGGGG - Intronic
1128263994 15:66252522-66252544 TCCCGAGACGCGGCTGCCGCTGG + Intronic
1128309656 15:66622255-66622277 CTCGGAGACGCCGCGGCCGCGGG - Intronic
1129851829 15:78797984-78798006 CCCGGAGAGGCTGGCACAGCGGG - Exonic
1130040894 15:80404525-80404547 CCCGGAGGGTTGACCGCCGCCGG - Exonic
1130251168 15:82301107-82301129 CCCGGAGAGGCTGGCACAGCGGG + Intergenic
1130517185 15:84634216-84634238 GGCGGGGACGCGGCCGCCGCGGG - Intergenic
1130928343 15:88401823-88401845 CCCAGAGAGGCAGCAGCTGCCGG - Intergenic
1131888644 15:96948011-96948033 CGCGGGGAGGCGGGCGGCGCGGG - Intergenic
1202955297 15_KI270727v1_random:72197-72219 CACCGGGAGGCGGCCGGCGCGGG + Intergenic
1132583780 16:697120-697142 CCCAGCGGAGCGGCCGCCGCTGG - Exonic
1132684726 16:1157566-1157588 CCCGGGGAGGCGGGCGCAGGCGG - Intronic
1132742320 16:1420974-1420996 CGAAGAGAGGCGGGCGCCGCGGG + Intergenic
1132870688 16:2114509-2114531 CACGTAGAGGCGGCCGTCGCGGG + Exonic
1132915197 16:2340369-2340391 CCCGGAGCCGAGGCCGCGGCAGG + Intronic
1133079287 16:3305687-3305709 GCTGGAGCGGCGGCGGCCGCAGG + Intronic
1134521843 16:14922395-14922417 CACGTAGAGGCGGCCGTCGCGGG - Intronic
1134709513 16:16321046-16321068 CACGTAGAGGCGGCCGTCGCGGG - Intergenic
1134716726 16:16361075-16361097 CACGTAGAGGCGGCCGTCGCGGG - Intergenic
1134950090 16:18347599-18347621 CACGTAGAGGCGGCCGTCGCGGG + Intergenic
1134958024 16:18391084-18391106 CACGTAGAGGCGGCCGTCGCGGG + Intergenic
1136153017 16:28364627-28364649 AACGGAGAGGCGGCGGCGGCCGG + Intergenic
1136210066 16:28750646-28750668 AACGGAGAGGCGGCGGCGGCCGG - Intergenic
1136234014 16:28903582-28903604 CCCGGAGATGTGGCCCCTGCAGG - Intronic
1136414533 16:30095544-30095566 CCCGGAGAGGCTGCTGGCTCTGG - Exonic
1142115882 16:88355878-88355900 ACCCAAGAGGCGGCCGCCGAGGG - Intergenic
1142150883 16:88512082-88512104 CCAGAAGGGGCGGCCGCCACGGG + Intronic
1142549798 17:731990-732012 CCCGGAGCGGCTGCAGCCGCTGG + Intergenic
1142855035 17:2724479-2724501 CCTGGGGAGGCGGCTGGCGCGGG + Intergenic
1143016370 17:3893058-3893080 CCCGGAGCCGCGGCGCCCGCGGG - Intronic
1143544705 17:7589230-7589252 CCCCCAGAGCGGGCCGCCGCTGG + Exonic
1143733443 17:8894303-8894325 CCGGGAGAGGGGGCAGCGGCAGG - Intronic
1144955606 17:19017471-19017493 CCTGGAGAGGAGGCCATCGCAGG + Intronic
1147486357 17:40818873-40818895 GCCGGAGCTGCTGCCGCCGCCGG + Exonic
1147720451 17:42536513-42536535 ACGGGCGTGGCGGCCGCCGCGGG + Exonic
1147994761 17:44354544-44354566 GGCGGCGAGGCGGGCGCCGCCGG - Exonic
1149461856 17:56834801-56834823 AGCGGAGAGGCGGCCGGCGCCGG + Exonic
1150485042 17:65537552-65537574 CCCGGCGAGGCGGCCGCGGGAGG + Exonic
1151558727 17:74859991-74860013 CCCGGAGCCGCGGACGCCGGCGG - Intronic
1151624977 17:75270963-75270985 CCCGGAGAGGTGGCTCCCGCCGG + Exonic
1152049233 17:77959233-77959255 CGCGGAGCCGCCGCCGCCGCCGG + Intergenic
1152331944 17:79678576-79678598 CCCGGGGAGGCGGCAGCCGCAGG - Intergenic
1152616824 17:81341714-81341736 CCCGGAGACCCGGGCACCGCCGG - Intergenic
1152755966 17:82087189-82087211 CCCGGAGATGTGGACGCCTCCGG + Exonic
1153219037 18:2846698-2846720 CCCCGGGACGCGGCCGCCGTCGG - Intergenic
1154448078 18:14450663-14450685 CACCGGGAGGCGGCCGGCGCGGG + Intergenic
1154940789 18:21111368-21111390 GCCCGAGCGGCGGCCGCAGCTGG - Exonic
1156275852 18:35581937-35581959 ACCGGGGACGCGGCCGCGGCGGG - Intronic
1158893577 18:61894260-61894282 GCCGGAGGAGCGGCGGCCGCCGG - Intergenic
1160685525 19:434771-434793 CCCGGGGAAGGAGCCGCCGCTGG - Exonic
1160824693 19:1074219-1074241 CCTGGAGAAGCGGACGACGCTGG + Exonic
1160957175 19:1699146-1699168 CCGGGCGGGGCGGGCGCCGCGGG + Intergenic
1161000435 19:1907993-1908015 CCCAGAGAGGAGGCAGCTGCCGG - Intronic
1161264894 19:3359610-3359632 CCCGGCGAGGGGGGGGCCGCAGG - Intronic
1161295731 19:3519316-3519338 CACGTAGACGCGGCTGCCGCAGG - Intronic
1161397871 19:4054349-4054371 CCCGGAGAGTCGCCCGGCTCGGG + Exonic
1162013165 19:7830246-7830268 CCCGGGACCGCGGCCGCCGCCGG - Intronic
1162435385 19:10654825-10654847 CGCGGGGAGGCGGCAGCCGGGGG - Intronic
1162914377 19:13866070-13866092 GCCGGAGGGGCGGCCCGCGCAGG - Intronic
1163771542 19:19194025-19194047 CCCGGAGAGGAGGCTGCAGATGG + Exonic
1164990349 19:32677964-32677986 CCCGGAGGGGCGGGCAGCGCGGG - Exonic
1165311174 19:35030318-35030340 CCCGGAGAGGCCGGTGCAGCGGG + Intergenic
1165849410 19:38840509-38840531 CCAGGAGAGGGGGCTGCCTCTGG + Exonic
1166079343 19:40434030-40434052 ACCCGGGAGGCGGCCGCGGCCGG - Intergenic
1167077042 19:47256574-47256596 GCCGGAGTCGCGGACGCCGCGGG + Exonic
1167148040 19:47694399-47694421 GGCGGAGAGGCGGCTGCGGCGGG - Exonic
1167209343 19:48123273-48123295 CCCGGAGCAGCTGCCGGCGCCGG + Exonic
1202693078 1_KI270712v1_random:104994-105016 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693102 1_KI270712v1_random:105081-105103 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693114 1_KI270712v1_random:105125-105147 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693126 1_KI270712v1_random:105169-105191 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693138 1_KI270712v1_random:105213-105235 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693150 1_KI270712v1_random:105257-105279 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693162 1_KI270712v1_random:105301-105323 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693174 1_KI270712v1_random:105345-105367 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693186 1_KI270712v1_random:105389-105411 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693198 1_KI270712v1_random:105433-105455 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693221 1_KI270712v1_random:105521-105543 GGCGGAGAGGCGGCCGGCGGCGG + Intergenic
1202693231 1_KI270712v1_random:105565-105587 GGCGGAGAGGCGGCCGGCGTCGG + Intergenic
925276836 2:2656177-2656199 CACGGAGAGGCAGCCCCCGCGGG + Intergenic
927472270 2:23385400-23385422 CCCGCAGCCGCGGCGGCCGCGGG - Exonic
928303518 2:30147297-30147319 CCTGGCGCGGCGGCCGCCGTCGG + Intronic
930358252 2:50346961-50346983 CGCCGAGGGGCAGCCGCCGCGGG + Intronic
932440371 2:71731085-71731107 CCCGCAGGGGCGCCCGGCGCCGG - Intergenic
934539125 2:95159778-95159800 TGCGCAGACGCGGCCGCCGCCGG + Intronic
934967012 2:98731574-98731596 CCCGGAGCGGGGCGCGCCGCTGG - Intergenic
935137672 2:100321866-100321888 TTCGGGGAGGCGGCCGGCGCGGG + Exonic
936412942 2:112276203-112276225 CTCGGGGAGGCGGGCGCGGCCGG - Intronic
937221249 2:120344394-120344416 CCCAGAGCGGCAGCCGCCGGCGG + Intergenic
940317006 2:152336201-152336223 CCCGGCGCGGCGCCCGCGGCCGG - Intronic
940883355 2:158968658-158968680 GCTGGAGCGGCGGCCGCCTCGGG + Exonic
941934667 2:170973634-170973656 CCCGGAGACCCCGCGGCCGCTGG - Intergenic
945041310 2:205745826-205745848 CCCGGAGAGGTGGTCGCCGGCGG + Exonic
948570114 2:238912562-238912584 CCCGGAGAGGCGGCCGCCGCAGG - Intergenic
948874697 2:240820349-240820371 ACGGGCGACGCGGCCGCCGCGGG + Intergenic
948880151 2:240852522-240852544 AGAGGAGAGGCGGCCGCGGCAGG - Intergenic
948903733 2:240968241-240968263 CCAGGAGAAGCGGCGGCTGCAGG + Intronic
948945882 2:241218472-241218494 CCGGGAGGGGCGGGCGCCGCCGG + Intronic
1170150508 20:13221729-13221751 CCCGGCGCGGCGGCCGGCGGCGG - Intergenic
1172272709 20:33663555-33663577 CCTGGACAAGCGGCAGCCGCTGG + Exonic
1175149860 20:56925245-56925267 GCCGGAGCGGCGGCGGGCGCGGG + Intergenic
1175215995 20:57391948-57391970 CCGGGAGAGGCGGCAGGTGCGGG - Intronic
1176140188 20:63541582-63541604 CCAGGAGTGGCGGCAGACGCAGG + Exonic
1176194606 20:63831385-63831407 CCCGGGGCGGTGGCCGCGGCCGG - Intergenic
1176547494 21:8208128-8208150 CCCGCAGAGGCGGCGGCTCCGGG - Intergenic
1176566445 21:8391175-8391197 CCCGCAGAGGCGGCGGCTCCGGG - Intergenic
1176888113 21:14281139-14281161 CCCGGAGAGGGGGACGTGGCAGG + Intergenic
1178535131 21:33404108-33404130 CCAGCAAAGGCGGCCCCCGCCGG - Intronic
1178680478 21:34669470-34669492 CCCGGAGAGCCAGGAGCCGCGGG + Exonic
1178872180 21:36385737-36385759 CCCGGGGAGGGGCCCGCCCCGGG - Intronic
1179209231 21:39312554-39312576 CCCGCAGAGGCGGCCGCACCTGG + Intronic
1179470175 21:41605111-41605133 CCGGGAGTGGAGGCCGCAGCAGG + Intergenic
1180110316 21:45644260-45644282 CCCGGAGCGGCCGCGGCGGCTGG + Intronic
1180259862 21:46661889-46661911 GCAGGAGGGGCAGCCGCCGCAGG + Exonic
1182508609 22:30803025-30803047 CTCGGAGAGGCGGTGGCAGCCGG + Intronic
1182736038 22:32532792-32532814 CCCGGGGAGGGGACGGCCGCAGG + Intronic
1183026177 22:35067256-35067278 CCCGGAGAAGCTGCGGCCTCAGG + Exonic
1183517108 22:38272966-38272988 CCCGGAGTCTCCGCCGCCGCCGG + Exonic
1184276503 22:43412031-43412053 CGCGGCGAGGCGGCCGCCGCCGG + Intronic
1184472189 22:44702279-44702301 CCCGGCGGGGCGGCCGGCGCGGG + Intronic
1184523487 22:45008793-45008815 CCCGATGAGGCGGCAGCCACAGG - Intronic
1184608190 22:45586305-45586327 CCTGCAGAGGCGGCCACGGCAGG - Intronic
1184738050 22:46410597-46410619 CGGGGAGAGGCGGCCACGGCGGG + Intronic
1185248677 22:49787638-49787660 ACCGCGGAGGCCGCCGCCGCCGG + Intronic
1185258284 22:49848604-49848626 CCCGGAGAAGGGGGTGCCGCCGG + Intergenic
1185278669 22:49960752-49960774 CCGGGCGAGGCGGCCGGGGCGGG + Exonic
1185345064 22:50307424-50307446 CGCGGAGCCGCAGCCGCCGCAGG + Intronic
950287608 3:11757381-11757403 CCTGGGGAGACGGCCGCCCCTGG - Intergenic
950487846 3:13283213-13283235 CGCGGAGCTGCGGCCGCAGCGGG + Intergenic
952287215 3:31980961-31980983 CCGGGGGAGGCGGCCGCAGGAGG - Exonic
956468633 3:69542621-69542643 CCCGGAGAGGCGGCGGGCGGGGG - Intergenic
956742955 3:72289274-72289296 CCCAGCGAGGCAGCCGCCGGAGG + Intergenic
956991573 3:74772447-74772469 GCTGGAGAGGTGGCAGCCGCTGG - Intergenic
960991046 3:123311611-123311633 CCAGGAGAGGAGGCGGCGGCAGG + Intronic
962806142 3:138929121-138929143 CCCTGCGAGGCTGCCGCCGACGG + Intergenic
968584765 4:1411104-1411126 GCTGCAGAGGCGGCCGCGGCTGG + Intergenic
968660085 4:1795241-1795263 GCCGGAGGGGCGGCCGCGGGGGG + Intronic
968959968 4:3738447-3738469 CCTGGAGAGACGGCTGCCCCAGG + Intergenic
969529039 4:7719697-7719719 CCCGGACGGGCAGCCGCAGCGGG - Intronic
972765790 4:42151704-42151726 CCAGGCGCGGCGGCGGCCGCCGG - Exonic
974047269 4:56908350-56908372 CCCGGCGGGGCCGCCGCCGCCGG - Intronic
977536538 4:98261314-98261336 CTCGGAGCCGCGCCCGCCGCAGG + Intergenic
984639373 4:182144858-182144880 CCCCGGGAGGCGGCGGACGCGGG + Intronic
988941379 5:36151607-36151629 CCCCGAGTGGCCGCCGCTGCGGG - Exonic
993905796 5:93621498-93621520 CCCGGAGAGGCGGAGGCCTCGGG - Intronic
995854121 5:116574827-116574849 ACCGGAGAGGCCGCCGCTCCCGG + Exonic
997013292 5:129904247-129904269 TCCGGAGAGGAGGCCGGCTCTGG + Intergenic
997505276 5:134411982-134412004 CCCGGAGCGGCGGCCTGCGGGGG + Intergenic
997647102 5:135488982-135489004 GCCGGGGAGGAGGCCGCCGAGGG + Intergenic
998446099 5:142199589-142199611 CCCAGAGAGGCGCCCGGTGCCGG - Intergenic
1002632591 5:180591233-180591255 CCCTGAGAGGGGGAGGCCGCGGG + Intronic
1003049415 6:2766049-2766071 CCCGCCGCGGCGGCGGCCGCCGG - Exonic
1003074406 6:2971149-2971171 ACGGAAGAGGCGGCCGGCGCGGG - Intronic
1003596922 6:7481933-7481955 CCAGGAGAGGGGGCTGCCTCTGG + Intergenic
1004044675 6:12012378-12012400 CGGGGAGCGGCGGCCGCCGGAGG + Exonic
1004422870 6:15487444-15487466 CCCGTGGAGGGGGCCGCTGCGGG - Exonic
1005669499 6:28091048-28091070 TCCGGGGAGGGAGCCGCCGCGGG - Intergenic
1005826240 6:29633050-29633072 CCCGGGGCGGCGGCAGCCACGGG + Exonic
1006725498 6:36196788-36196810 CCGGGAGCGGCGGCGGCGGCCGG + Exonic
1007760109 6:44128273-44128295 GCTGGAGAGGCGGCCGGCCCCGG + Intronic
1007783147 6:44265454-44265476 CCCGGGAAGGAGGCCGCCGCGGG - Exonic
1012410179 6:98947816-98947838 CCGGGAGAGGCGCGCGCCGCGGG + Exonic
1013349193 6:109290547-109290569 CTCGGAGCGGCGGCCGTCGCTGG - Intergenic
1019411271 7:907864-907886 TCCGGAGAGGCGGCGCCCACTGG - Intronic
1020106232 7:5423486-5423508 CCGGGAGCCGGGGCCGCCGCCGG - Exonic
1023064817 7:36366954-36366976 CCCGGGGCGGCGGGCTCCGCGGG + Intronic
1027711674 7:81611230-81611252 ACCGGAGAGGAGGCCGGCGGAGG - Intergenic
1028922403 7:96322268-96322290 GCCGCAGAGGCCGCCGCTGCTGG - Intergenic
1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG + Exonic
1029459433 7:100686665-100686687 CCCGGCGAGACGGCGACCGCTGG - Exonic
1029461096 7:100694214-100694236 CACAGAGGAGCGGCCGCCGCGGG - Intergenic
1030270050 7:107661095-107661117 CCCCAAGAGGCGGACGCTGCAGG - Intronic
1032391284 7:131556712-131556734 CCCGGCCCGGCCGCCGCCGCTGG - Intronic
1034129185 7:148699437-148699459 CCTGGTGAGGCGACCTCCGCGGG + Intronic
1034339184 7:150341196-150341218 CCCGGCGCGGGGGCTGCCGCGGG + Exonic
1035303884 7:157917172-157917194 CCAGGACAGGCTGCCGCAGCTGG + Intronic
1035404235 7:158587740-158587762 CCCAGGGAGGCGCGCGCCGCCGG + Intronic
1036723697 8:11200976-11200998 GCCGGAGCCGCCGCCGCCGCAGG - Exonic
1037768898 8:21787683-21787705 CCAGGAAAGGCGGACCCCGCAGG + Intronic
1037882331 8:22579267-22579289 CGCGGAGAGGAGCCCGGCGCCGG - Exonic
1038359931 8:26865990-26866012 CCCGGAGGGGCGACTGCGGCTGG + Intronic
1040055900 8:43056555-43056577 TCCCGAGCCGCGGCCGCCGCGGG - Intronic
1040512213 8:48105544-48105566 CCCCGCGAGGCGGCAGCCCCTGG - Intergenic
1041059394 8:54021921-54021943 CCCGGGGACGCGGGCGCGGCGGG + Intronic
1045568319 8:103343723-103343745 TCTGGAGAGGTGGCCGCCTCTGG - Intergenic
1045847884 8:106658319-106658341 GCCGGGGTGGCGGCCGCCGGGGG + Intronic
1048461610 8:134626003-134626025 CCCTGAGAGCCAGCAGCCGCAGG + Intronic
1051855324 9:21559282-21559304 CCCGGAGCGCCGGCCGCCCTTGG - Intergenic
1052048595 9:23821911-23821933 CGCGGCGCCGCGGCCGCCGCCGG + Intronic
1053202703 9:36163563-36163585 TCCGGGGAGGCGGCCGGGGCAGG + Exonic
1055574693 9:77648862-77648884 CTCGGAGAAGGAGCCGCCGCTGG + Intergenic
1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG + Intergenic
1057307720 9:93921779-93921801 CCCTGAGAGGCTGCCGGGGCTGG - Intergenic
1060849263 9:126860885-126860907 CGCGGGCAGGCGGCCGGCGCGGG + Intronic
1061015961 9:127980885-127980907 CCGGGCGAGGCGGGCGCCACCGG - Intergenic
1061298381 9:129689700-129689722 CCCGGAGAGTCGGACTCCACAGG - Intronic
1062427223 9:136511585-136511607 CCAGGAGAGGCGGCCTCAGTCGG + Intronic
1185464784 X:347670-347692 CCAGTAGAGGGGGCAGCCGCAGG + Exonic
1187226053 X:17376010-17376032 CACGGAGAGGCGTCCGTGGCTGG + Exonic
1189310436 X:40014124-40014146 CCAGGAGAGGCGGCGACGGCGGG - Intergenic
1195894681 X:109733335-109733357 CCCGGAGGGGCGGGCGGAGCGGG + Exonic
1197746024 X:129932534-129932556 CGGGGAGCGGCGGCTGCCGCAGG - Intergenic
1198388139 X:136147717-136147739 CCCCGAGCGGCGGCGGCGGCGGG - Intronic
1200256408 X:154585306-154585328 CCAGGAGAGGCGGGTGCCACGGG + Exonic
1200261361 X:154619097-154619119 CCAGGAGAGGCGGGTGCCACGGG - Exonic
1200267344 X:154653394-154653416 CCAGGAGAGGCGGGTGCCACGGG - Exonic
1201222949 Y:11789438-11789460 CCAGGAGAGGCGGCGGCCAGTGG + Intergenic