ID: 948575364

View in Genome Browser
Species Human (GRCh38)
Location 2:238946468-238946490
Sequence CAGGATAACCAGCTGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948575364_948575366 3 Left 948575364 2:238946468-238946490 CCTCTCTGCAGCTGGTTATCCTG No data
Right 948575366 2:238946494-238946516 TCTGCCGCTATCAGCAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948575364 Original CRISPR CAGGATAACCAGCTGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr