ID: 948580481

View in Genome Browser
Species Human (GRCh38)
Location 2:238984398-238984420
Sequence CTGACTACACAGATGGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948580481_948580483 -4 Left 948580481 2:238984398-238984420 CCAGTGTCCATCTGTGTAGTCAG No data
Right 948580483 2:238984417-238984439 TCAGCTTCTCACTCTGCAACAGG No data
948580481_948580484 6 Left 948580481 2:238984398-238984420 CCAGTGTCCATCTGTGTAGTCAG No data
Right 948580484 2:238984427-238984449 ACTCTGCAACAGGTAACTAAAGG No data
948580481_948580485 14 Left 948580481 2:238984398-238984420 CCAGTGTCCATCTGTGTAGTCAG No data
Right 948580485 2:238984435-238984457 ACAGGTAACTAAAGGAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948580481 Original CRISPR CTGACTACACAGATGGACAC TGG (reversed) Intergenic
No off target data available for this crispr