ID: 948580483

View in Genome Browser
Species Human (GRCh38)
Location 2:238984417-238984439
Sequence TCAGCTTCTCACTCTGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948580477_948580483 27 Left 948580477 2:238984367-238984389 CCCGGCCGCTCTGTTTGTATACA No data
Right 948580483 2:238984417-238984439 TCAGCTTCTCACTCTGCAACAGG No data
948580478_948580483 26 Left 948580478 2:238984368-238984390 CCGGCCGCTCTGTTTGTATACAC No data
Right 948580483 2:238984417-238984439 TCAGCTTCTCACTCTGCAACAGG No data
948580481_948580483 -4 Left 948580481 2:238984398-238984420 CCAGTGTCCATCTGTGTAGTCAG No data
Right 948580483 2:238984417-238984439 TCAGCTTCTCACTCTGCAACAGG No data
948580480_948580483 22 Left 948580480 2:238984372-238984394 CCGCTCTGTTTGTATACACGGTC No data
Right 948580483 2:238984417-238984439 TCAGCTTCTCACTCTGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948580483 Original CRISPR TCAGCTTCTCACTCTGCAAC AGG Intergenic
No off target data available for this crispr