ID: 948580484

View in Genome Browser
Species Human (GRCh38)
Location 2:238984427-238984449
Sequence ACTCTGCAACAGGTAACTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948580482_948580484 -1 Left 948580482 2:238984405-238984427 CCATCTGTGTAGTCAGCTTCTCA No data
Right 948580484 2:238984427-238984449 ACTCTGCAACAGGTAACTAAAGG No data
948580481_948580484 6 Left 948580481 2:238984398-238984420 CCAGTGTCCATCTGTGTAGTCAG No data
Right 948580484 2:238984427-238984449 ACTCTGCAACAGGTAACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948580484 Original CRISPR ACTCTGCAACAGGTAACTAA AGG Intergenic
No off target data available for this crispr