ID: 948580485

View in Genome Browser
Species Human (GRCh38)
Location 2:238984435-238984457
Sequence ACAGGTAACTAAAGGAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948580481_948580485 14 Left 948580481 2:238984398-238984420 CCAGTGTCCATCTGTGTAGTCAG No data
Right 948580485 2:238984435-238984457 ACAGGTAACTAAAGGAAGCATGG No data
948580482_948580485 7 Left 948580482 2:238984405-238984427 CCATCTGTGTAGTCAGCTTCTCA No data
Right 948580485 2:238984435-238984457 ACAGGTAACTAAAGGAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948580485 Original CRISPR ACAGGTAACTAAAGGAAGCA TGG Intergenic
No off target data available for this crispr