ID: 948580697

View in Genome Browser
Species Human (GRCh38)
Location 2:238985864-238985886
Sequence GTCTCGGAGCTTTCTTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948580697_948580708 12 Left 948580697 2:238985864-238985886 CCCTCCCAAGAAAGCTCCGAGAC No data
Right 948580708 2:238985899-238985921 AGGAAGGGTCCCTCGGCTCGTGG No data
948580697_948580706 5 Left 948580697 2:238985864-238985886 CCCTCCCAAGAAAGCTCCGAGAC No data
Right 948580706 2:238985892-238985914 CTGTACCAGGAAGGGTCCCTCGG No data
948580697_948580711 29 Left 948580697 2:238985864-238985886 CCCTCCCAAGAAAGCTCCGAGAC No data
Right 948580711 2:238985916-238985938 TCGTGGTGCTGCAGTGAGCCAGG No data
948580697_948580701 -8 Left 948580697 2:238985864-238985886 CCCTCCCAAGAAAGCTCCGAGAC No data
Right 948580701 2:238985879-238985901 TCCGAGACAAAACCTGTACCAGG No data
948580697_948580703 -4 Left 948580697 2:238985864-238985886 CCCTCCCAAGAAAGCTCCGAGAC No data
Right 948580703 2:238985883-238985905 AGACAAAACCTGTACCAGGAAGG No data
948580697_948580704 -3 Left 948580697 2:238985864-238985886 CCCTCCCAAGAAAGCTCCGAGAC No data
Right 948580704 2:238985884-238985906 GACAAAACCTGTACCAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948580697 Original CRISPR GTCTCGGAGCTTTCTTGGGA GGG (reversed) Intergenic