ID: 948580701

View in Genome Browser
Species Human (GRCh38)
Location 2:238985879-238985901
Sequence TCCGAGACAAAACCTGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948580693_948580701 20 Left 948580693 2:238985836-238985858 CCTGCGTCACACCGGGGAACGAC No data
Right 948580701 2:238985879-238985901 TCCGAGACAAAACCTGTACCAGG No data
948580697_948580701 -8 Left 948580697 2:238985864-238985886 CCCTCCCAAGAAAGCTCCGAGAC No data
Right 948580701 2:238985879-238985901 TCCGAGACAAAACCTGTACCAGG No data
948580696_948580701 -5 Left 948580696 2:238985861-238985883 CCTCCCTCCCAAGAAAGCTCCGA No data
Right 948580701 2:238985879-238985901 TCCGAGACAAAACCTGTACCAGG No data
948580689_948580701 29 Left 948580689 2:238985827-238985849 CCAAGGTCACCTGCGTCACACCG No data
Right 948580701 2:238985879-238985901 TCCGAGACAAAACCTGTACCAGG No data
948580694_948580701 9 Left 948580694 2:238985847-238985869 CCGGGGAACGACTCCCTCCCTCC No data
Right 948580701 2:238985879-238985901 TCCGAGACAAAACCTGTACCAGG No data
948580698_948580701 -9 Left 948580698 2:238985865-238985887 CCTCCCAAGAAAGCTCCGAGACA No data
Right 948580701 2:238985879-238985901 TCCGAGACAAAACCTGTACCAGG No data
948580695_948580701 -4 Left 948580695 2:238985860-238985882 CCCTCCCTCCCAAGAAAGCTCCG No data
Right 948580701 2:238985879-238985901 TCCGAGACAAAACCTGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948580701 Original CRISPR TCCGAGACAAAACCTGTACC AGG Intergenic
No off target data available for this crispr