ID: 948580706

View in Genome Browser
Species Human (GRCh38)
Location 2:238985892-238985914
Sequence CTGTACCAGGAAGGGTCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948580699_948580706 1 Left 948580699 2:238985868-238985890 CCCAAGAAAGCTCCGAGACAAAA No data
Right 948580706 2:238985892-238985914 CTGTACCAGGAAGGGTCCCTCGG No data
948580694_948580706 22 Left 948580694 2:238985847-238985869 CCGGGGAACGACTCCCTCCCTCC No data
Right 948580706 2:238985892-238985914 CTGTACCAGGAAGGGTCCCTCGG No data
948580696_948580706 8 Left 948580696 2:238985861-238985883 CCTCCCTCCCAAGAAAGCTCCGA No data
Right 948580706 2:238985892-238985914 CTGTACCAGGAAGGGTCCCTCGG No data
948580700_948580706 0 Left 948580700 2:238985869-238985891 CCAAGAAAGCTCCGAGACAAAAC No data
Right 948580706 2:238985892-238985914 CTGTACCAGGAAGGGTCCCTCGG No data
948580697_948580706 5 Left 948580697 2:238985864-238985886 CCCTCCCAAGAAAGCTCCGAGAC No data
Right 948580706 2:238985892-238985914 CTGTACCAGGAAGGGTCCCTCGG No data
948580695_948580706 9 Left 948580695 2:238985860-238985882 CCCTCCCTCCCAAGAAAGCTCCG No data
Right 948580706 2:238985892-238985914 CTGTACCAGGAAGGGTCCCTCGG No data
948580698_948580706 4 Left 948580698 2:238985865-238985887 CCTCCCAAGAAAGCTCCGAGACA No data
Right 948580706 2:238985892-238985914 CTGTACCAGGAAGGGTCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948580706 Original CRISPR CTGTACCAGGAAGGGTCCCT CGG Intergenic
No off target data available for this crispr